ID: 923212162

View in Genome Browser
Species Human (GRCh38)
Location 1:231813348-231813370
Sequence TTCATAAGCACAGCCTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923212159_923212162 -3 Left 923212159 1:231813328-231813350 CCCAGAAGACATGTTGGGACTTC 0: 1
1: 0
2: 1
3: 10
4: 152
Right 923212162 1:231813348-231813370 TTCATAAGCACAGCCTAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 122
923212160_923212162 -4 Left 923212160 1:231813329-231813351 CCAGAAGACATGTTGGGACTTCA 0: 1
1: 0
2: 0
3: 8
4: 148
Right 923212162 1:231813348-231813370 TTCATAAGCACAGCCTAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923212162 Original CRISPR TTCATAAGCACAGCCTAAGG AGG Intronic
900830930 1:4964898-4964920 TCCTTAATCACAGCCTCAGGAGG + Intergenic
901760541 1:11468557-11468579 TTCAGAAGCACAGCCTGTTGTGG + Intergenic
902089851 1:13894271-13894293 TTCATGAGCACAGACTAATGAGG - Intergenic
903577386 1:24347288-24347310 CACATAAGCACAGCTTAAGAGGG + Intronic
903784020 1:25844946-25844968 CTCATAAGCATGCCCTAAGGAGG + Intronic
904031360 1:27535491-27535513 TTCCTCAGAACAGCCTAAGTTGG - Intronic
905745274 1:40411059-40411081 TTCATAAGATCAGCCTGAAGTGG - Intronic
908128354 1:61051172-61051194 TTCATTAGCACCGCATTAGGAGG + Intronic
913666953 1:121057550-121057572 TGCACAACCACAGCCTGAGGAGG - Intergenic
914018698 1:143844974-143844996 TGCACAACCACAGCCTGAGGAGG - Intergenic
914657251 1:149753177-149753199 TGCACAACCACAGCCTGAGGAGG - Intergenic
920318040 1:205093587-205093609 TACACAAACACAGCCTTAGGTGG + Intronic
920874410 1:209820933-209820955 GTCATTAGTCCAGCCTAAGGTGG - Intergenic
923136681 1:231126079-231126101 TTCCCCAGCACAGCCTTAGGAGG - Intergenic
923212162 1:231813348-231813370 TTCATAAGCACAGCCTAAGGAGG + Intronic
923487373 1:234446910-234446932 TTCATAAGCACATCCAGAAGAGG + Exonic
1064604711 10:17026692-17026714 TGGATAAGCAAAGCCCAAGGGGG + Intronic
1065973625 10:30824094-30824116 TTCATTAGCACTGCCTTGGGCGG - Intronic
1070742619 10:78912864-78912886 TTCACAAGCCCAGCCGAAGGAGG + Intergenic
1071705299 10:87991889-87991911 TTCAAATTCACAACCTAAGGGGG - Intergenic
1078133300 11:8631476-8631498 TTATTAAGCAGAGCATAAGGAGG + Intronic
1082099865 11:48163681-48163703 TACAAAAGCAAAGCCTAAGAGGG + Intronic
1087042423 11:93814921-93814943 TTCATCAGCAATACCTAAGGAGG - Intergenic
1087229754 11:95647094-95647116 TTAAAGAGAACAGCCTAAGGAGG + Intergenic
1088056112 11:105581103-105581125 TTCATAAGCACTGCTTTAGATGG - Intergenic
1095556807 12:43516384-43516406 TTCATAAGCAAAGCATCATGTGG + Intronic
1096007011 12:48181749-48181771 TCCATAAGCACAGCTGAAGTGGG - Intergenic
1096692424 12:53329169-53329191 ATCATTAGCATAGCCTGAGGTGG + Exonic
1099296198 12:80830951-80830973 TTAATCAGTACAGCGTAAGGAGG - Intronic
1100382461 12:94074382-94074404 TTCATACGCACAGAATAACGTGG - Intergenic
1106513676 13:30433848-30433870 TACATATGCACAGCCTAAAATGG - Intergenic
1106863657 13:33939244-33939266 CTCATTAGCACAGACTCAGGTGG - Intronic
1108843600 13:54651591-54651613 TTCATAAGCTCAGCCAAGGCAGG - Intergenic
1110356525 13:74573906-74573928 TTTAAAAGAAAAGCCTAAGGAGG - Intergenic
1110792561 13:79601591-79601613 ATCAGAAACACAGCATAAGGGGG - Intergenic
1111493190 13:89012119-89012141 TTCATTGGCAGAGGCTAAGGTGG - Intergenic
1111789024 13:92828777-92828799 TTCATAAGCACAGCATTACATGG + Intronic
1114379925 14:22191910-22191932 TTCATAAGCCCAGCAGAAGGTGG + Intergenic
1117488707 14:56225225-56225247 TTCAGAGGCACAGGCTGAGGTGG + Intronic
1120581041 14:86249474-86249496 TTCAGTAGCACAGCATAAGAGGG - Intergenic
1123873928 15:24605056-24605078 GGCAGAAGCACAGCCTTAGGTGG - Intergenic
1125901035 15:43347600-43347622 TTCTTAAGCACATCCTTATGAGG + Intronic
1129880929 15:79005595-79005617 TTGAGAAGCAAAGGCTAAGGTGG + Intronic
1130835882 15:87649517-87649539 TTCATCACCACAGCCTGGGGTGG + Intergenic
1131342844 15:91619038-91619060 TTCAGAAGCACAGATGAAGGGGG + Intergenic
1132816533 16:1831266-1831288 CCCAGAAGCACAGCCTAAGATGG + Intronic
1138237356 16:55395896-55395918 TTCAGAACCACTGCCTTAGGAGG + Intronic
1138983691 16:62300944-62300966 TTCAAAGGCACAGACTCAGGTGG - Intergenic
1139659699 16:68412150-68412172 TTCCTAGGAAAAGCCTAAGGAGG + Intronic
1140263401 16:73399885-73399907 TTCTTAAGCCCAGCCTCTGGGGG - Intergenic
1149425916 17:56554495-56554517 CTCATTAGCACTGCCTAAAGGGG + Intergenic
1159716933 18:71835608-71835630 TGCATGAGGACAGCCTAATGTGG + Intergenic
1160032083 18:75270897-75270919 TTCATGAGCAGAACCAAAGGAGG + Intronic
1166651044 19:44575416-44575438 TTTATAAGCATAGGGTAAGGAGG + Intergenic
1168289097 19:55348294-55348316 TTTACAAGCACAGCCTGAGTGGG - Intergenic
927224929 2:20755031-20755053 TTCTTAAGAACATCTTAAGGAGG + Intronic
929583511 2:43099567-43099589 TTCATACACACAGGCTCAGGAGG + Intergenic
932971266 2:76545822-76545844 TTTATAAGCAAAGAGTAAGGTGG + Intergenic
935033807 2:99348258-99348280 TTCATAAGGACATCGTAAGCTGG + Intronic
935646145 2:105336888-105336910 TTCCTCAGAACAGCCTAATGAGG - Intergenic
941192281 2:162400074-162400096 TTCATAAGAACAGTTTAAGATGG - Intronic
944882977 2:204033785-204033807 TTCAAAAGATAAGCCTAAGGCGG - Intergenic
948484662 2:238272651-238272673 TTCTTAAGCACACCCAAAGGTGG - Intronic
1169814658 20:9644088-9644110 TTCTTAAGCCCAGCCAAAGATGG + Intronic
1170221310 20:13944959-13944981 TTCATGACCACAGACTAAGGAGG - Intronic
1172680282 20:36708735-36708757 TTAAAAAGCACAGCCCAAGCCGG + Intronic
1174671135 20:52308627-52308649 TTCAGAAGCAGAGCCTGAGACGG - Intergenic
1177165028 21:17591280-17591302 TTAATCATCACAGCCTCAGGGGG - Intronic
1184983992 22:48116990-48117012 TTAATAAGCACAGCATGCGGGGG - Intergenic
949277443 3:2301635-2301657 ATCATAATCACAGCAAAAGGAGG + Intronic
950462761 3:13135206-13135228 CTCATAAGCACAGTTCAAGGAGG + Intergenic
951836241 3:26986501-26986523 TTAATAAGCACAACCTAAAAAGG + Intergenic
954791360 3:53135750-53135772 CTCAGAAGCACTGCCTGAGGTGG + Intergenic
955899865 3:63740982-63741004 TTAAAAAGCACTGCCAAAGGTGG + Intergenic
958834395 3:99127391-99127413 TTTATAAGCAGAGACTAAGAAGG - Intergenic
963867913 3:150382847-150382869 TTCATATGCACAGTCTAAAAAGG - Intergenic
964544421 3:157818005-157818027 TTTATAATCACAGACTAATGAGG - Intergenic
964898775 3:161631225-161631247 TTAATAACCACAGCAAAAGGTGG + Intergenic
965628774 3:170709215-170709237 TCCAGATGCACAGGCTAAGGGGG - Intronic
966122412 3:176537048-176537070 ATCCCAAGCCCAGCCTAAGGAGG + Intergenic
968296580 3:197581513-197581535 GCCACAAGCACAGCCTAATGCGG + Intergenic
970131578 4:12877010-12877032 TTTATAGGCACAGGATAAGGTGG + Intergenic
970591481 4:17563981-17564003 ATCACAGGCACAGCCTAAGCAGG - Intergenic
971178223 4:24302388-24302410 TTCATAACCACAGCCTGCGAAGG - Intergenic
979573947 4:122264463-122264485 TTGCTAAGCAATGCCTAAGGAGG - Intronic
983563274 4:169122906-169122928 TTTATGGGCACAGCCTAATGGGG + Intronic
985930696 5:3055051-3055073 TTCATAAGCACATGCTTTGGGGG + Intergenic
986765768 5:10924613-10924635 TTCGCACACACAGCCTAAGGAGG - Intergenic
992488033 5:77214480-77214502 TTGGTAAGCAAAGCCTAATGAGG + Intronic
993600726 5:89921300-89921322 TTCCTAAGCACAGGTAAAGGAGG - Intergenic
1000391038 5:160723801-160723823 TTTTTAAGCACAGACTCAGGAGG - Intronic
1003728381 6:8792192-8792214 TTTATAAGCATAGGGTAAGGAGG - Intergenic
1006348900 6:33506248-33506270 TTCATAAGCACACGATGAGGGGG - Intergenic
1008028992 6:46672102-46672124 CAAATAAGCACAGCCTAAGCTGG + Intronic
1011282411 6:85690112-85690134 TTCAGAGGCACAGCCTAATCAGG - Intergenic
1017260386 6:152378847-152378869 CTCATAATCACAGCCTAGGTGGG - Intronic
1019949572 7:4360549-4360571 TTTATAAGCATAGCGTAATGAGG + Intergenic
1025474876 7:60906924-60906946 TTCATAATCCCAGCATCAGGAGG + Intergenic
1025488022 7:61076068-61076090 TTCATAATCCCAGCATCAGGAGG - Intergenic
1025512127 7:61582950-61582972 TTCATAATCCCAGCATCAGGAGG - Intergenic
1028297162 7:89148071-89148093 CTCCTAAGCACAGCCTATGTAGG - Intronic
1030721394 7:112875131-112875153 TTTATAAGCACAGGGTAATGAGG - Intronic
1032572563 7:133016001-133016023 ATCACAAGAACAGCCTTAGGAGG + Intronic
1036182554 8:6597833-6597855 CTCATAAGCACATCCTAGGTGGG + Intronic
1038088756 8:24230138-24230160 TTCCTCAACACAGCCTGAGGTGG - Intergenic
1038898432 8:31813929-31813951 TTAATAAGCAAAGTCTTAGGGGG + Intronic
1039723024 8:40185177-40185199 TTCCAAAGTCCAGCCTAAGGAGG - Intergenic
1042614368 8:70632344-70632366 TTTATAAGCACAGACTTTGGAGG + Intronic
1047513154 8:125530756-125530778 TGCTTAAGCACAGGATAAGGAGG + Intergenic
1048909597 8:139122332-139122354 TTCATTAGGACAGTCTAAGATGG + Intergenic
1048911393 8:139138793-139138815 TTCATTAGGACAGTCTAAGATGG + Intergenic
1049326819 8:142025883-142025905 TTCTTACGCACAGCCTAATTTGG + Intergenic
1051336324 9:16069730-16069752 TCCTTTTGCACAGCCTAAGGCGG + Intergenic
1051832160 9:21291796-21291818 TTCATCAGTATAGCCAAAGGTGG + Intergenic
1054566484 9:66765991-66766013 TTTATAAGCATAGGCTAATGAGG - Intergenic
1055686542 9:78781157-78781179 TTTAAAAGGACAGCCTCAGGTGG - Intergenic
1057576244 9:96244988-96245010 GTCATAAAAACAGCCTGAGGAGG - Intronic
1057833730 9:98427511-98427533 TTGATAACCACACTCTAAGGTGG + Intronic
1058928752 9:109697080-109697102 TCTAGAAGCACAACCTAAGGGGG - Intronic
1059636969 9:116180467-116180489 TTACTAAGCACAGACTAAGTGGG - Intronic
1061855912 9:133441867-133441889 CTCCTTAGCCCAGCCTAAGGTGG + Intronic
1062693823 9:137861060-137861082 TTTCTAACCACAGCCTGAGGAGG - Intronic
1185738832 X:2513976-2513998 TTCAGAAGCAGAGCCTCAGCTGG + Intergenic
1186604200 X:11072169-11072191 TTCAGATGCACTGCCTAATGTGG + Intergenic
1189568705 X:42272366-42272388 TTCATAAGCATAGAATAAGGTGG + Intergenic
1192683440 X:73278356-73278378 AACATCAGCACAGCCCAAGGTGG + Intergenic
1192708639 X:73556150-73556172 TACATTAGTACAGCCTAAAGAGG + Intergenic
1195989229 X:110666194-110666216 ATAAAAAGCACAGCCTTAGGGGG - Intergenic
1197985087 X:132258347-132258369 TTCATTAGCACTGACCAAGGTGG + Intergenic