ID: 923212162

View in Genome Browser
Species Human (GRCh38)
Location 1:231813348-231813370
Sequence TTCATAAGCACAGCCTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923212159_923212162 -3 Left 923212159 1:231813328-231813350 CCCAGAAGACATGTTGGGACTTC 0: 1
1: 0
2: 1
3: 10
4: 152
Right 923212162 1:231813348-231813370 TTCATAAGCACAGCCTAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 122
923212160_923212162 -4 Left 923212160 1:231813329-231813351 CCAGAAGACATGTTGGGACTTCA 0: 1
1: 0
2: 0
3: 8
4: 148
Right 923212162 1:231813348-231813370 TTCATAAGCACAGCCTAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923212162 Original CRISPR TTCATAAGCACAGCCTAAGG AGG Intronic