ID: 923213508

View in Genome Browser
Species Human (GRCh38)
Location 1:231828390-231828412
Sequence GACTGAGTAACAGTAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923213506_923213508 -9 Left 923213506 1:231828376-231828398 CCACTGTTTTCAGAGACTGAGTA 0: 1
1: 0
2: 1
3: 11
4: 256
Right 923213508 1:231828390-231828412 GACTGAGTAACAGTAGTGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 116
923213504_923213508 -2 Left 923213504 1:231828369-231828391 CCCAACTCCACTGTTTTCAGAGA 0: 1
1: 0
2: 3
3: 10
4: 240
Right 923213508 1:231828390-231828412 GACTGAGTAACAGTAGTGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 116
923213503_923213508 4 Left 923213503 1:231828363-231828385 CCTTCACCCAACTCCACTGTTTT 0: 1
1: 0
2: 1
3: 29
4: 326
Right 923213508 1:231828390-231828412 GACTGAGTAACAGTAGTGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 116
923213505_923213508 -3 Left 923213505 1:231828370-231828392 CCAACTCCACTGTTTTCAGAGAC 0: 1
1: 0
2: 0
3: 15
4: 211
Right 923213508 1:231828390-231828412 GACTGAGTAACAGTAGTGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 116
923213502_923213508 5 Left 923213502 1:231828362-231828384 CCCTTCACCCAACTCCACTGTTT 0: 1
1: 0
2: 1
3: 30
4: 289
Right 923213508 1:231828390-231828412 GACTGAGTAACAGTAGTGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923213508 Original CRISPR GACTGAGTAACAGTAGTGGC TGG Intronic
903788397 1:25875949-25875971 GGCTGAGTAAGCGTAGGGGCCGG - Intergenic
904301399 1:29556973-29556995 GTCTGAGCAACAGGAGTGACAGG - Intergenic
904630193 1:31835488-31835510 GAGTCAGTGACAGTGGTGGCAGG - Intergenic
906708395 1:47911493-47911515 TCCTGAGTCACAGAAGTGGCTGG + Intronic
914764958 1:150629569-150629591 GACTGAGCAACCCTAGTGACAGG - Exonic
915192646 1:154164557-154164579 GTCTGAGCTAGAGTAGTGGCAGG - Intronic
916124357 1:161556111-161556133 GAGTGGGTAACAGTTGTGGTGGG + Intergenic
916134242 1:161637469-161637491 GAGTGGGTAACAGTTGTGGTGGG + Intronic
916575781 1:166065138-166065160 GCCTGATAAACAGTAGTGGCTGG + Intronic
916894261 1:169145591-169145613 GTCTGAGCAAGAGTAGGGGCTGG - Intronic
920369863 1:205472067-205472089 TACTGAGTGTCACTAGTGGCCGG + Intergenic
922999638 1:229996408-229996430 TACTGAGAAACAGTCCTGGCTGG - Intergenic
923213508 1:231828390-231828412 GACTGAGTAACAGTAGTGGCTGG + Intronic
923567566 1:235087990-235088012 GACTGAGGAACAGAAGGGGCGGG - Intergenic
1063783297 10:9351111-9351133 CACTGAGTATCACTAGTGGCAGG + Intergenic
1063942303 10:11142909-11142931 GACTGAGTAACCCCAGTGGAGGG - Intronic
1064529073 10:16288722-16288744 GACTGAGTGAGAGTAGGGGTTGG + Intergenic
1065467939 10:26045187-26045209 GACTGAGTACCAGTGGTGTCTGG + Intronic
1069577454 10:69541018-69541040 GACTGAGGAACAGAGGTGCCAGG + Intergenic
1069786733 10:70993043-70993065 GACTGAGTTCCAGTAATGGAAGG - Intergenic
1070101095 10:73387648-73387670 GAATGAGCACCAGCAGTGGCTGG - Intronic
1071944807 10:90632466-90632488 GTTTGAGGAACAGTAGTGACCGG + Intergenic
1080807913 11:35672622-35672644 GACTGAGGAACATTGGTGTCTGG + Intronic
1085785396 11:79443806-79443828 GACTTAGGAAGAGTAGAGGCAGG + Intergenic
1091966110 12:4743265-4743287 TACTGACTAAAAGTAGTGCCTGG + Intronic
1092030577 12:5280281-5280303 GAGTGAGTCACAGTATGGGCCGG + Intergenic
1094608896 12:31974196-31974218 TCCTGAGTAACAGGAGTGTCTGG - Intronic
1096973160 12:55683528-55683550 AACTGAGAAACAGGAGTGGAGGG - Intronic
1101426503 12:104592627-104592649 GACTGAGCAAGAGAAATGGCAGG - Intronic
1105435016 13:20368957-20368979 GACTGAGAGAAAGTAGTTGCAGG + Intergenic
1106578465 13:30997931-30997953 GACTAACTGACAGAAGTGGCAGG - Intergenic
1107337555 13:39371595-39371617 GACAGAGGGACAGTCGTGGCAGG - Intronic
1111279590 13:86003327-86003349 GCCTGAGAAACAGGAGTGGCAGG - Intergenic
1115760408 14:36575368-36575390 GACTGAGTAACATGAGTGGTGGG + Intergenic
1116715603 14:48421878-48421900 CACAGAGTGACAGTAGTGGAAGG + Intergenic
1118313742 14:64711303-64711325 GACTGTGTTACAGTAGAGCCTGG + Intronic
1120051493 14:79872111-79872133 GACTGAGCAACTTTAGTGGAAGG + Intergenic
1125260945 15:37824051-37824073 GACTGTGGGACAGTAATGGCAGG - Intergenic
1125925567 15:43560177-43560199 GAATGAGTAACATTAGGGGGTGG + Intronic
1125938711 15:43659728-43659750 GAATGAGTAACATTAGGGGGTGG + Intronic
1126992241 15:54392536-54392558 GTTTGAGTAACAGTACTGACAGG + Intronic
1128248657 15:66150051-66150073 GACTGAGTCAGAGCTGTGGCGGG + Intronic
1130213910 15:81950964-81950986 GCCTGTGTAACAGCAGAGGCTGG + Intergenic
1132731318 16:1363653-1363675 GGCTGAGGCACAGCAGTGGCTGG - Exonic
1135025923 16:18998932-18998954 GACTTTGTAACAGTAGTGTCAGG - Intronic
1135491800 16:22915736-22915758 GACTGATGAAAACTAGTGGCAGG - Exonic
1136768141 16:32810031-32810053 GCCTGAGCCACAGTAGTAGCTGG + Intergenic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1138302692 16:55945846-55945868 GACTGAGTGATAGTAGGAGCTGG - Intronic
1142012126 16:87720894-87720916 GACTGAGTGACTGGAGAGGCAGG - Intronic
1145889654 17:28405793-28405815 GCCTGCGTAATGGTAGTGGCGGG - Intronic
1147368237 17:39973654-39973676 CACTGAGTCACAGTAATGCCAGG + Intronic
1150515995 17:65809836-65809858 GACTGAGTAAAGGAAGTGGGGGG + Intronic
1151306799 17:73267775-73267797 GACTGAGCAGCAGCAGCGGCGGG - Intergenic
1151960842 17:77404870-77404892 GACTCAGTGACAGTGGTTGCTGG + Intronic
1153326606 18:3826948-3826970 GACTGAGAAACAGTAGTTAAGGG + Intronic
1157638517 18:49187212-49187234 GACTGTGTACCAGCAGCGGCCGG - Intronic
1158468337 18:57711922-57711944 GACTGAGGGACAGGAGAGGCAGG + Intronic
1162686743 19:12392871-12392893 GGCTGAGTAAGAGGAGGGGCTGG - Intronic
1162691092 19:12432645-12432667 GGCTGAGTAAGAGGAGGGGCTGG - Intronic
1165422625 19:35729894-35729916 GACTCAGTGACAGTGGTGCCTGG + Intronic
929880989 2:45837231-45837253 GACTGAGAAACAGGAGTTGAGGG + Intronic
930170386 2:48245776-48245798 GACTGGGTAATAGTAGAGACCGG + Intergenic
937964945 2:127498379-127498401 AACCTAGTAACACTAGTGGCTGG - Intronic
940948666 2:159647047-159647069 GACTGGGTAAGTGTAGAGGCTGG - Intergenic
943127734 2:183816551-183816573 TACTTAGAAACAGTAGTGTCAGG + Intergenic
945691846 2:213046345-213046367 GATTGAGAAGCAGTAGTAGCAGG - Intronic
945823911 2:214697605-214697627 GACTGAGCAACCCTAGTGACAGG + Intergenic
946419469 2:219556890-219556912 AACTGACTAAAAGGAGTGGCAGG - Intronic
947773269 2:232687689-232687711 GACAGAGTTACAGTAGTGGAGGG - Intergenic
948489805 2:238305282-238305304 CAGTGAGTAGCAGTGGTGGCAGG - Intergenic
948828056 2:240583660-240583682 GACAGAGCAAGAGGAGTGGCAGG + Intergenic
1169762053 20:9107063-9107085 GACTGGGTAACAGTTGAAGCTGG - Intronic
1173011957 20:39191029-39191051 GACTGAGAGTCAGTAGAGGCAGG - Intergenic
1175538932 20:59736260-59736282 CTCTGAATAACAGTAGTGCCAGG - Intronic
1176195538 20:63835108-63835130 GACTGAGCAACACCACTGGCTGG - Intergenic
1176621234 21:9063723-9063745 GACTGAGCAATATTAGTGTCCGG + Intergenic
1181759462 22:25048264-25048286 CACTGAGAAACAGAATTGGCAGG + Intronic
1182200714 22:28566458-28566480 TACTCAGTTACAGTAGTGGTAGG - Intronic
1182907371 22:33949847-33949869 GACTGAGAGACAGGAGTAGCTGG - Intergenic
1184237170 22:43188989-43189011 GACTGAGTCTCAGTTGTGTCAGG + Intergenic
954139078 3:48595710-48595732 GGCTGAATCACAGGAGTGGCCGG - Intergenic
954776202 3:53020758-53020780 TACTAAGTAAAAGTAGAGGCCGG + Intronic
955383932 3:58463634-58463656 AACTGAGTATCAGTAGGAGCAGG - Intergenic
959991744 3:112638815-112638837 GACCGAGTCACTGTTGTGGCTGG + Exonic
961088162 3:124087945-124087967 GTCTGAGCAACAGTAGTAGAAGG - Intronic
961988325 3:131160457-131160479 CAGTGTGTACCAGTAGTGGCTGG - Intronic
962209954 3:133469306-133469328 GACAGAATAACAGGAATGGCTGG - Intronic
964829660 3:160869975-160869997 GATTGAGTAACAGTGGCAGCTGG - Intronic
965466159 3:169032917-169032939 GGATGAGTAACAGTGGAGGCTGG - Intergenic
965732119 3:171783200-171783222 GGCTGAGTATCAGTGGAGGCAGG + Intronic
978139875 4:105306412-105306434 GGCTGTGTGACAGCAGTGGCTGG - Intergenic
978902750 4:113972422-113972444 GACTGAGTGAGAGTAGAGGAGGG - Intronic
978910025 4:114051488-114051510 GACTGAGAGACAGGACTGGCTGG + Intergenic
986836029 5:11638590-11638612 GACAGAGCAAGAGTAGTGGGTGG - Intronic
988245284 5:28672789-28672811 GACTGTTTAAAAGTAGTGACTGG - Intergenic
990441985 5:55855787-55855809 TACTGACTACCAGCAGTGGCTGG - Intronic
992298154 5:75347620-75347642 GTCTAAGTAACAGCAGGGGCTGG - Intronic
993231803 5:85246713-85246735 AACAAAGTAACAGTGGTGGCAGG - Intergenic
995762958 5:115583641-115583663 GTCTGAGTCACAGTGGTGGTGGG - Intronic
996215130 5:120856741-120856763 AACAGACTCACAGTAGTGGCAGG - Intergenic
996410378 5:123152178-123152200 GACTGATTTTCAGTGGTGGCAGG + Intronic
999691289 5:154148049-154148071 AACTGAGTGACAGTAGAGACTGG + Intronic
1001421126 5:171588163-171588185 GACTGGATAACAGTGCTGGCTGG + Intergenic
1002409627 5:179063260-179063282 GCATTAGTAACAGTAGTAGCTGG + Intronic
1003286257 6:4736317-4736339 GACTAAGTTACAGTTGTTGCTGG + Intronic
1006084915 6:31588751-31588773 GACTGAGACACAGAAGTGGGGGG - Exonic
1008011014 6:46467929-46467951 GATGGACTGACAGTAGTGGCTGG + Intronic
1008945067 6:57088517-57088539 AACTCAGTAACTGTAGTTGCAGG - Intronic
1013685891 6:112581897-112581919 AAATGAGCCACAGTAGTGGCGGG - Intergenic
1031619816 7:123922718-123922740 GATTGAGCAACAGCAGAGGCAGG - Intergenic
1038302351 8:26364440-26364462 CACGGATAAACAGTAGTGGCTGG - Intronic
1039831568 8:41219402-41219424 GAGTGGGTAACTGTACTGGCTGG + Intergenic
1040761357 8:50849327-50849349 GACTGAGGAGCAGTAGTGCCGGG - Intergenic
1040879754 8:52192078-52192100 GATGGAGTAGCATTAGTGGCAGG + Intronic
1051878066 9:21811674-21811696 GTCTGAGTACCAGCAGTAGCAGG - Intronic
1052209073 9:25879498-25879520 GACTGACTACCTGTTGTGGCTGG - Intergenic
1056830295 9:89911786-89911808 GAGTGAGAGACAGTTGTGGCTGG + Intergenic
1061358630 9:130125669-130125691 AAATGAGTAAAAATAGTGGCCGG - Intronic
1061530445 9:131207877-131207899 GACTGAGAAAATGTACTGGCTGG + Intronic
1188753400 X:33930971-33930993 TACTGAGTCACGGTGGTGGCAGG + Intergenic
1193581030 X:83262747-83262769 GACTGAGAGACAGGACTGGCTGG - Intergenic
1194810876 X:98385451-98385473 AACTGAGAAACAGTAGATGCAGG - Intergenic
1197615052 X:128681558-128681580 AACTGAGTAACAGTAATAGGTGG - Intergenic
1197615192 X:128682828-128682850 AACTGAGTAACAGTAATAGGTGG - Intergenic
1199325350 X:146492556-146492578 AACTGGGTAACAGGAGAGGCTGG + Intergenic