ID: 923217988

View in Genome Browser
Species Human (GRCh38)
Location 1:231867696-231867718
Sequence TGGGAAGATCTATCAACAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923217988 Original CRISPR TGGGAAGATCTATCAACAAC AGG (reversed) Intronic
905913841 1:41671781-41671803 TGGGAAGATTTGCAAACAACTGG - Intronic
910686082 1:89917879-89917901 TGTGAAGAGCTACCAACAAGAGG - Intronic
911806833 1:102221117-102221139 TGATAATATCTGTCAACAACTGG + Intergenic
912030538 1:105237124-105237146 TGTTAAAATCTATCAACAATTGG - Intergenic
912234967 1:107840849-107840871 TGTGAAGAACTATAAACCACTGG + Intronic
918155719 1:181844565-181844587 TGGGAAGAGATATGAACAATTGG + Intergenic
921071150 1:211658875-211658897 TGATGAGATCTATCAAAAACAGG + Intronic
923217988 1:231867696-231867718 TGGGAAGATCTATCAACAACAGG - Intronic
1066095531 10:32068695-32068717 TGGGGAGAGCTGTCAACAGCAGG + Intergenic
1068845921 10:61673649-61673671 AGGGAAGGTTTATCAAGAACAGG + Intronic
1073283192 10:102369734-102369756 TGGCAAGATCTCTCTACAGCGGG + Exonic
1073998674 10:109345278-109345300 TGGGGAGAGGCATCAACAACAGG + Intergenic
1074505317 10:114064851-114064873 TGGGAAGAGCAAGCAACAGCAGG + Intergenic
1074691412 10:116007999-116008021 TGGAAAGATATATAAAGAACTGG - Intergenic
1075537686 10:123284564-123284586 TGGCAACAGCTATCAACAACAGG - Intergenic
1079679483 11:23275961-23275983 TGGCCAAATCTATCAACAGCGGG - Intergenic
1081261997 11:40972362-40972384 TGGGAAGATCACTTAAGAACAGG - Intronic
1083466746 11:62852206-62852228 TGGGAAGTTCAATCAACAATTGG + Intergenic
1088512466 11:110592109-110592131 GGAGAAGATCTATCATAAACTGG - Exonic
1089000731 11:115050086-115050108 TGTGATGATCCATCAACAATTGG + Intergenic
1089672447 11:120065846-120065868 TGGGAAGAACTTGCAATAACTGG + Intergenic
1091220015 11:133925130-133925152 TGGGAAGAGATATGTACAACAGG + Intronic
1098442876 12:70536552-70536574 TGGTAAGATATATCATCCACAGG + Intronic
1099037494 12:77607378-77607400 TGGGAAGATGACTGAACAACTGG + Intergenic
1101572194 12:105963956-105963978 TGGAAAGATCTATAAATAATAGG + Intergenic
1106583730 13:31039047-31039069 TGGGAAGATCTGGTAAAAACTGG + Intergenic
1106861129 13:33909927-33909949 TGGGAAGGTCTATCATAAAAAGG + Intronic
1107954554 13:45498111-45498133 TGGGATGAAATATTAACAACTGG - Intronic
1111190629 13:84802091-84802113 TTTGAAGATCTATCAGCAAATGG + Intergenic
1115820593 14:37208816-37208838 TGGGAAGATCACTTGACAACAGG - Intronic
1116300005 14:43166951-43166973 TGGGAGGATCTATCAAGACCTGG + Intergenic
1116478638 14:45370644-45370666 TGGGAAGATATATTATCAACAGG + Intergenic
1120628421 14:86858136-86858158 TGGCAAGATTTTTCAAAAACTGG - Intergenic
1120669681 14:87349551-87349573 TGGGAATATCTATTATCAATTGG - Intergenic
1120950679 14:90038875-90038897 TCTGAAGATCTTTCAAAAACAGG - Intronic
1125331126 15:38583003-38583025 GAGGAAGATCTACCAACAAATGG + Intergenic
1125340946 15:38674672-38674694 GAGGAACATCTTTCAACAACAGG - Intergenic
1125908289 15:43413828-43413850 TGGGAGGATCTATCTACAAGGGG - Intronic
1126555624 15:49984574-49984596 TGGCCAGATCTATCAACAGAAGG - Intronic
1127438786 15:58985657-58985679 TGGGATGATTTAGCAACATCCGG - Intronic
1131080529 15:89530922-89530944 TGGGAGGTTCTCTCAACAGCCGG + Intergenic
1140077351 16:71713818-71713840 TGGTAATAACTATCAAGAACAGG + Intronic
1143851071 17:9812511-9812533 TGGGGTGGTTTATCAACAACAGG + Intronic
1150352222 17:64454317-64454339 TGGGAGGATCTCTTAAGAACAGG - Intronic
1155662449 18:28265829-28265851 TGGGAAGATATATAAAGAAAGGG - Intergenic
1156354462 18:36329378-36329400 TGGGAAGAGCCATGAACACCAGG - Intronic
1156426900 18:37023638-37023660 TGGGAAGACCTGTCAACCATTGG + Intronic
1157894380 18:51450120-51450142 TGGGAAGATTTCTCTAGAACTGG - Intergenic
1159283821 18:66323091-66323113 TGGCAAAATATATCAACAAAGGG + Intergenic
1164415835 19:28045913-28045935 TGAGAATAGCTATGAACAACTGG - Intergenic
925622053 2:5803746-5803768 TGAGAAGATCTGACAACAGCAGG + Intergenic
928202830 2:29261664-29261686 TGGGAAGCACTATCAAGAAAAGG - Intronic
929714176 2:44293715-44293737 TTGGAAGGTCTACCAACACCAGG - Intronic
939663307 2:144918133-144918155 TGGGAAGAGATTTCATCAACTGG - Intergenic
942122769 2:172794419-172794441 TGGGAAGATTTGACAACATCTGG + Intronic
942726878 2:179019394-179019416 TGTGAAGACATATCAACACCAGG + Intronic
948280353 2:236742243-236742265 TGTGAAGATCTGTAAACCACTGG + Intergenic
1169873132 20:10268929-10268951 TGGGAACATTTGTCCACAACTGG + Intronic
1172106522 20:32520373-32520395 AGGGAAGATGTATCATTAACAGG + Intronic
1173329347 20:42061651-42061673 TGGGAAACCCTATCAACATCTGG + Intergenic
1177831573 21:26145134-26145156 TGGGGAGAACTATCAAAAGCTGG + Intronic
1182662658 22:31936005-31936027 TGGGAAGCTCTGCCAGCAACGGG - Intronic
949950794 3:9227122-9227144 TGGGAAGATCTAGGAACACTGGG - Intronic
951792849 3:26505279-26505301 TTGGAAGATGTATCAAAATCTGG - Intergenic
957521464 3:81323868-81323890 TGGAAAGATCCATCAACAGCTGG + Intergenic
959837661 3:110939394-110939416 TGGGTAGGTCTATCAGCAAGAGG + Intergenic
964011365 3:151896039-151896061 AGGAAAGATATGTCAACAACAGG - Intergenic
967152653 3:186664024-186664046 TGGGAAGAGGCATCAAGAACAGG - Intronic
967448897 3:189599551-189599573 TGGGAAGCCCAATCAGCAACAGG + Intergenic
970106275 4:12588820-12588842 TTGGAAGTCCTACCAACAACTGG - Intergenic
970146574 4:13042364-13042386 TGGGATGAACTATGATCAACGGG + Intergenic
970338719 4:15082163-15082185 AGGGAAGAGCTATGAAAAACAGG - Intergenic
970941138 4:21635450-21635472 TGGAAAGATCCATCAAAAAGTGG + Intronic
972574363 4:40338452-40338474 AGAGAAGCTCTTTCAACAACAGG - Intronic
974287234 4:59884250-59884272 TGGTAAGATCTATTAATAGCTGG + Intergenic
975448832 4:74500711-74500733 AGGGAAGATATACCAGCAACTGG + Intergenic
988582507 5:32480333-32480355 TGGGAAGAACTCCCACCAACAGG - Intergenic
988770915 5:34432599-34432621 GAGGAAGATCTACCAACAAATGG - Intergenic
989037006 5:37184911-37184933 AGGGAATATCTGTCAACACCTGG + Exonic
990138231 5:52673154-52673176 TGGAAAGATCCAGGAACAACAGG + Intergenic
991269046 5:64757639-64757661 TGTGAACATCCATCAACATCTGG + Intronic
995462102 5:112414409-112414431 AGGGAAGATCTGGCAACATCTGG + Intronic
997313155 5:132907312-132907334 TGGGAAGTTCTATGAAAAATAGG - Intronic
999884357 5:155904276-155904298 TGGTAAGTTCTATCAAGAATGGG - Intronic
999916354 5:156266703-156266725 TGGGAAGATCTATTGAGCACAGG - Intronic
1000450126 5:161375351-161375373 TCAGAAGATCTAGCAACAGCGGG + Intronic
1000599473 5:163254484-163254506 TGGGAAGAGCTATTCACATCTGG - Intergenic
1001130629 5:169060729-169060751 AGAGAAGTTCTATGAACAACAGG + Intronic
1002397891 5:178972159-178972181 TGGGCAGATCACTCAACATCAGG - Intergenic
1003706355 6:8535605-8535627 TGAGAAGAACTTTGAACAACAGG - Intergenic
1006337245 6:33427279-33427301 TGGGCAGATCTGCCAACCACAGG - Intronic
1010677431 6:78760418-78760440 GAGGAAGATCTACCAACAAATGG + Intergenic
1012535463 6:100291663-100291685 TGGGTAGATCTGGCAACATCAGG + Intergenic
1019773442 7:2897922-2897944 TGGGAAGAGGTATCCACAATCGG + Intergenic
1023812001 7:43918985-43919007 GGGGAAGAGCTGGCAACAACTGG + Intronic
1024167962 7:46753767-46753789 TGGGATTATAGATCAACAACTGG + Intronic
1028114368 7:86981141-86981163 TGTGAAGAGCTAGCAGCAACTGG - Intronic
1034963426 7:155376134-155376156 TGCGAAGATCCAGCCACAACTGG - Intergenic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1035371286 7:158380621-158380643 ATGGTAGATCTACCAACAACTGG - Intronic
1037057910 8:14467327-14467349 GGGGAAGAGCTTTCAACAATGGG + Intronic
1041003062 8:53470653-53470675 TGAGAAAATCTATCTGCAACAGG + Intergenic
1051900225 9:22030468-22030490 TGGGAAAATTTTTCAACACCAGG - Intronic
1189623464 X:42869478-42869500 TAGGAAGATCTATGTATAACAGG + Intergenic
1195812512 X:108850263-108850285 TGGGAAGTTCTAACTACAAAGGG + Intergenic