ID: 923220882

View in Genome Browser
Species Human (GRCh38)
Location 1:231891882-231891904
Sequence TCTGCATTGTAGAAAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923220882_923220889 21 Left 923220882 1:231891882-231891904 CCTTCCCCTTTCTACAATGCAGA 0: 1
1: 0
2: 0
3: 21
4: 290
Right 923220889 1:231891926-231891948 AGTTTCACAGGTATCTTTACAGG 0: 1
1: 0
2: 1
3: 10
4: 160
923220882_923220888 9 Left 923220882 1:231891882-231891904 CCTTCCCCTTTCTACAATGCAGA 0: 1
1: 0
2: 0
3: 21
4: 290
Right 923220888 1:231891914-231891936 CAGTTCAACAGAAGTTTCACAGG 0: 1
1: 0
2: 1
3: 18
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923220882 Original CRISPR TCTGCATTGTAGAAAGGGGA AGG (reversed) Intronic
900094832 1:936137-936159 TCTGCCCTGTGGAAAGGGGGTGG - Intronic
902954267 1:19914135-19914157 TGTGCATTGGAGGAAGGGAAAGG - Intergenic
902989323 1:20175212-20175234 TCAGCACTCTAGTAAGGGGAGGG - Intronic
906125871 1:43426637-43426659 TCTGGGTTGAAGAAAGGGGGAGG - Intronic
906203935 1:43976931-43976953 TCTGCTTTGCAGAGTGGGGATGG + Intronic
906212960 1:44022322-44022344 TCTCCATGGTAGGAAGGGGCAGG + Intronic
906830624 1:49027675-49027697 TCTTCAATATAGAATGGGGATGG - Intronic
908664329 1:66473293-66473315 TGTGCATTGCAGAAAGGGTTTGG - Intergenic
909158991 1:72120260-72120282 ACTGCATTGTAAAAAGGAGAGGG + Intronic
909470271 1:76020056-76020078 TCTGCTTTGTTAAGAGGGGAAGG + Intergenic
909538201 1:76761799-76761821 GCTACATGGTAGAAAGGGCAAGG - Intergenic
913062821 1:115223489-115223511 TCTGCTTTGTAGGAAGGTGACGG - Intergenic
913072896 1:115317131-115317153 TTTGCATGGTGGAGAGGGGATGG + Intronic
916914925 1:169396200-169396222 TGTGCATTGTAGAAATGGAGCGG - Intronic
920687119 1:208117747-208117769 TCCACTTTGTAGAAAGGAGAGGG - Intronic
923220882 1:231891882-231891904 TCTGCATTGTAGAAAGGGGAAGG - Intronic
924678047 1:246201350-246201372 TCTGCATGGTAGAAAAGTGCTGG - Intronic
924848856 1:247802889-247802911 TCTGCCTTGTAAAAAATGGAAGG + Intergenic
1063576414 10:7265911-7265933 CCTGCATTCTAGCTAGGGGAAGG + Intronic
1064184688 10:13151249-13151271 TCTGCATTTTAAAAAGTGCAAGG - Intergenic
1068164596 10:53312542-53312564 TCTACATTATAAAAAGGGAAGGG - Intergenic
1068628665 10:59276966-59276988 TCTGCATTTCAGAAATGGCATGG + Intronic
1070208552 10:74289858-74289880 TCTCCTTTGTAGAAAAAGGAGGG + Intronic
1070777184 10:79116496-79116518 TGAGCATGGTAGGAAGGGGAAGG + Intronic
1072618965 10:97067478-97067500 TCTCCTTTGTATAATGGGGATGG - Intronic
1073458338 10:103651139-103651161 TCTGCATAGTGGAAAGAAGAAGG + Intronic
1073653392 10:105385764-105385786 TCTGCCTTGTTAGAAGGGGAGGG + Intergenic
1073785692 10:106886723-106886745 TCTGGATTCTAGAAAGAGAATGG - Intronic
1073811568 10:107157860-107157882 TCTGCAGTGGCCAAAGGGGATGG - Intronic
1076187115 10:128458642-128458664 ACTGCTTTGTATAAATGGGAAGG - Intergenic
1077988987 11:7384853-7384875 TCTGCATTTGAGGAAGGGCAAGG - Intronic
1078918129 11:15800111-15800133 TCTACATGGGAGAAAAGGGAAGG - Intergenic
1080883425 11:36343867-36343889 TCTACATTGTAAAAAGAGCATGG - Intronic
1081621799 11:44623118-44623140 TCTGCAGGGGAGAAAGGCGATGG - Intergenic
1083163380 11:60869123-60869145 TCTGCAGTGGGGGAAGGGGAGGG - Exonic
1084795553 11:71502338-71502360 TCTGGATAGTAGAAAGTGGGGGG + Intronic
1084795611 11:71502646-71502668 TCTGGATAGTAGAAAGTGGGGGG + Intronic
1084795628 11:71502724-71502746 TCTGGATAGTAGAAAGTGGGGGG + Intronic
1084795656 11:71502845-71502867 TCTGGATAGTAGAAAGTGGCGGG + Intronic
1085989689 11:81827132-81827154 TCAGGATGGAAGAAAGGGGATGG + Intergenic
1086595889 11:88569993-88570015 GCTTCGTTGTAGAAAGGGAAGGG + Intronic
1087231599 11:95672241-95672263 TCTGCCGTGCAGAAAGGAGAAGG - Intergenic
1087248207 11:95865550-95865572 TCTGCACAGTAGAACGGAGAAGG + Intronic
1088824078 11:113478877-113478899 TCTGGATTGTGAAATGGGGATGG + Intergenic
1089681892 11:120123151-120123173 TCTGCCTGGGAGATAGGGGAAGG - Intronic
1090674067 11:128972832-128972854 TCTCCACTGTAGAAACGGGGTGG + Exonic
1090883407 11:130854502-130854524 TCATTATTGTAGAAATGGGAAGG - Intergenic
1091217680 11:133913211-133913233 TTTGCAATGGAGATAGGGGAGGG - Intronic
1092465839 12:8730665-8730687 TTTGCATTGTGGAAAGGGTAGGG + Intronic
1093908950 12:24724329-24724351 AATGCAGTGTAGACAGGGGAAGG + Intergenic
1095471324 12:42540386-42540408 TCTTCATTGGTGAAATGGGAAGG + Intronic
1095661344 12:44740786-44740808 TCTGAATTTTAGAAAGAGGCAGG + Intronic
1096081733 12:48837827-48837849 TCTGGAGTTTGGAAAGGGGAAGG - Intronic
1096531234 12:52244075-52244097 TCTGCAGTGGAGAGAGGGGGAGG + Intronic
1096844667 12:54399567-54399589 ACTGCAGTGGAGAAAGGGGTGGG + Intronic
1096930283 12:55200377-55200399 TCTGCACTGTACCAAGGGAATGG - Intergenic
1098358579 12:69633609-69633631 TCTGGATTGTAGGAAAGGTAAGG - Intergenic
1098675227 12:73282257-73282279 TCTGCATTGTGGCAAGTGGAAGG + Intergenic
1098960193 12:76731903-76731925 TTTGCATTGTGGAAAAGGGGAGG - Intergenic
1099056208 12:77844232-77844254 TCTGCATCGTCCACAGGGGAGGG + Intronic
1100059021 12:90549515-90549537 TTTGCAGTGTACAAACGGGAAGG + Intergenic
1100677108 12:96879774-96879796 ACTGCACGGGAGAAAGGGGAAGG - Intergenic
1100707932 12:97221660-97221682 TGTGCATTGGAGAAGGGGGCTGG + Intergenic
1101281898 12:103266316-103266338 TCTTTATTTTAGAAAGTGGATGG + Intronic
1101673566 12:106898101-106898123 TCTTCACTGTAGAGAGAGGAGGG + Intergenic
1102558861 12:113747928-113747950 TTTGCATTCTAGAAGGGAGATGG - Intergenic
1103010372 12:117453944-117453966 TCTGCCTTGTAGACGGGGGGAGG + Exonic
1105478402 13:20749306-20749328 TCTACATTGTAGTAGGAGGATGG - Intronic
1107436616 13:40386000-40386022 TCTCCATTTTCAAAAGGGGAAGG - Intergenic
1108016686 13:46083992-46084014 CCTGCATTTTAGATAAGGGACGG + Intronic
1109243558 13:59923798-59923820 CCTGCATTGTAGAAAAGAGATGG + Intronic
1110862826 13:80362418-80362440 TCTGCTTTGGAGAGATGGGATGG + Intergenic
1111116139 13:83780016-83780038 TCTGCATAGGAAAAAGGAGATGG - Intergenic
1111465327 13:88601080-88601102 TCTGCAGTGGAAAAAGGTGAAGG - Intergenic
1111882872 13:93980481-93980503 TCTGCATTGGAAATAGGGCAGGG + Intronic
1113387440 13:109862011-109862033 TTTGCATTGTAGAAAGAAGAAGG + Intergenic
1114037237 14:18641134-18641156 TCTGCAATGTAAAAAAGGAAAGG + Intergenic
1114724973 14:24926398-24926420 TCTGCCATGTAGAAATGGCACGG + Intronic
1115338825 14:32270640-32270662 TCTGCAATGCAGAAAAGGCAAGG - Intergenic
1115456795 14:33613343-33613365 TCAGCAATATAGGAAGGGGAAGG - Intronic
1118634389 14:67734359-67734381 TCTGCATGATTGAAATGGGAAGG - Exonic
1118983634 14:70735016-70735038 TTTGCCTTTTAAAAAGGGGATGG - Intronic
1119774282 14:77238907-77238929 TCAGCTTTTTAGAATGGGGAGGG + Intronic
1120557764 14:85950150-85950172 TCTTCTTTATAGAAAGGAGATGG + Intergenic
1120964164 14:90152920-90152942 ACTGCATTGTAGTAAGGGCCTGG + Intronic
1121116154 14:91344325-91344347 TTTGCATAATAAAAAGGGGAAGG - Intronic
1121533020 14:94671815-94671837 TTTGTTTTGAAGAAAGGGGAGGG + Intergenic
1123871455 15:24578876-24578898 TCCGGATTTTAGCAAGGGGAAGG + Intergenic
1124108403 15:26763041-26763063 TATGCATCCTAGAAAGGGGGCGG - Intronic
1124875323 15:33586628-33586650 GCTGCGTTGTATAAAAGGGAAGG - Intronic
1125229915 15:37441963-37441985 CATGCATTGGGGAAAGGGGAGGG + Intergenic
1125454396 15:39842603-39842625 TCTTTATGGTGGAAAGGGGAAGG - Intronic
1125642862 15:41246224-41246246 TCTTCTTTGTAGAAAGTGGGTGG + Intronic
1126511551 15:49480781-49480803 ACTGCACTTTACAAAGGGGATGG - Intronic
1128026820 15:64444830-64444852 TAAGGATTGTAGAAAGGTGAAGG + Intronic
1129063068 15:72876449-72876471 TCTGCAATGCAGAAAAGTGAAGG - Intergenic
1129972692 15:79793921-79793943 TTTGAATTGGAGAAAAGGGATGG - Intergenic
1131794225 15:95997774-95997796 TCTGCAGTGTAGAAAGAGTTAGG + Intergenic
1131975033 15:97935764-97935786 TCTGCACTGTAGTGTGGGGAGGG - Intergenic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1138770889 16:59662237-59662259 TCTTCATTGTAGAAAAGAAAAGG - Intergenic
1140237712 16:73173834-73173856 CCTGTATGGCAGAAAGGGGAAGG + Intergenic
1142007263 16:87695431-87695453 TCTGCGTGGTAGGAAGTGGAGGG + Intronic
1143944426 17:10577924-10577946 TCAGAATTGTAGATAAGGGATGG + Intergenic
1145115161 17:20203140-20203162 TCTACAGTGTAGGAAGGGCACGG - Intronic
1145180581 17:20747452-20747474 TTTGCAATGAAGAAAGGTGAAGG + Intergenic
1146531533 17:33611332-33611354 TCTGGATTCCAGAGAGGGGAAGG - Intronic
1147235021 17:39050928-39050950 TCAGAATTGAAGGAAGGGGAAGG + Intergenic
1148138266 17:45309745-45309767 TCAGCATTTAGGAAAGGGGATGG - Intronic
1148360706 17:47010100-47010122 TCAGAATTGAAGGAAGGGGAAGG + Intronic
1148831009 17:50431415-50431437 TCTGGTTTGTGGAAATGGGAGGG + Intronic
1149840181 17:59956435-59956457 TTTGCAGTGAAGAAAGGTGAAGG + Intronic
1150098789 17:62403420-62403442 GCTGCAGTGTGGAAAGTGGATGG - Intronic
1150135610 17:62693264-62693286 TCTGGTTTGGAGCAAGGGGAAGG + Exonic
1150785831 17:68162058-68162080 TCAGAATTGAAGGAAGGGGAAGG - Intergenic
1155802386 18:30124217-30124239 TCTGCTTTTTAGAAAGGGAATGG - Intergenic
1157289508 18:46399752-46399774 TCTGCTCTGAAGAAAGGGCAGGG - Intronic
1158506745 18:58053197-58053219 TCTGCCTGGTAGACAGGAGATGG - Intronic
1162833408 19:13300903-13300925 TCTTCATTGTAGGAAGAGAAGGG - Intronic
1162965065 19:14151615-14151637 TCTGCAGGGCAGAAAGGGGCTGG + Exonic
1165380021 19:35472596-35472618 ACTGCAATGTAGAGAGTGGATGG - Intergenic
1166488835 19:43239745-43239767 TCTTCTTTGGAGAAATGGGAGGG + Intronic
925927473 2:8680577-8680599 TTTGCATTTCAGAAAGCGGAAGG - Intronic
926260981 2:11261436-11261458 TCTGTATTGAATAAAGGAGAAGG - Intronic
926398591 2:12471139-12471161 TGTGCTTTGAAGAAAGAGGAAGG + Intergenic
927095276 2:19743625-19743647 TCTGCTCTGTAGAATGGAGATGG - Intergenic
928382944 2:30836413-30836435 TCAGCGGTGAAGAAAGGGGAAGG + Intergenic
931461766 2:62456305-62456327 TCTGGATGCTAGAAAGGGCAAGG - Intergenic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
936349907 2:111704628-111704650 TCTGGTTTGGTGAAAGGGGATGG + Intergenic
936661697 2:114550150-114550172 CCTGCATTTTAGAAAGCTGAGGG - Intronic
936933192 2:117811431-117811453 TCTACATTGTAGAAAGCAGATGG - Intergenic
938906834 2:135845088-135845110 TTTCCTCTGTAGAAAGGGGAAGG + Intronic
939329404 2:140737951-140737973 TCTGCATTGGAAAAAGTGCATGG - Intronic
943094502 2:183412149-183412171 TAGGCATTGCAGAAAGGGAATGG + Intergenic
944273657 2:197810519-197810541 TCTCCATTGTAAAAAGGGAAAGG - Intronic
946359435 2:219210229-219210251 GCTGCATCGTGGAGAGGGGACGG - Exonic
946516808 2:220420941-220420963 CCTTCATTGTAGAAAGGAGCAGG + Intergenic
947996312 2:234530646-234530668 TCTGCATTGCAGAAGGGAGGAGG - Intergenic
948087576 2:235264404-235264426 TTTGCTTTGAAGAAAGAGGAAGG + Intergenic
948126604 2:235568773-235568795 TCTGGATGCTAGAAAAGGGAAGG - Intronic
948154911 2:235773480-235773502 TCTGCCTTGCAGAAAAGGCAGGG + Intronic
1170445655 20:16424706-16424728 TCTGCACTGTGGAAGGGTGAGGG + Intronic
1171289467 20:23973365-23973387 TGTGCATTACAGCAAGGGGAGGG + Intergenic
1174246268 20:49183677-49183699 TCTGGACTTTAGAATGGGGATGG + Intronic
1174723486 20:52838053-52838075 CCTGAATTCTAGAAATGGGACGG + Intergenic
1175366214 20:58457987-58458009 TCTGCCTGGGAGAAAAGGGATGG + Intergenic
1175602557 20:60286860-60286882 TCTGCCATGCAGAAAGGGGGTGG - Intergenic
1180289036 22:10780138-10780160 ACTGCCTTGTAGAGAGGGGCTGG - Intergenic
1180461360 22:15568182-15568204 TCTGCAATGTAAAAAAGGAAAGG + Intergenic
1181034779 22:20164669-20164691 TGTGCATTGTGGAGTGGGGAGGG + Intergenic
1181509038 22:23380690-23380712 TGCGCATTGTAGAGTGGGGAGGG - Intergenic
949120172 3:374852-374874 TCTGCATAGTAATAAGGAGAAGG - Intronic
949189318 3:1232794-1232816 TCTGAATTGGAGAAAAGGCAAGG + Intronic
950696470 3:14704538-14704560 TCAGCATTGTCAAGAGGGGAAGG + Exonic
950764557 3:15263750-15263772 CCTGCCTTGAAGAAAGAGGAGGG + Intronic
952529252 3:34246290-34246312 TCTGCAGTGTGGAATGAGGACGG + Intergenic
952903733 3:38126398-38126420 TCTGCAAAGTAGAAGTGGGAGGG - Intronic
953645707 3:44752130-44752152 TCTGCAATGCAGAAAAGGCAAGG - Exonic
953982403 3:47419257-47419279 CCTGCATTGGGGAAAGGGGATGG + Intronic
954228788 3:49200126-49200148 TCTGCAGTGGAGGAACGGGAGGG + Intronic
955001001 3:54928033-54928055 TCTGCATTGAAGAAAAGCAAGGG - Exonic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955728074 3:61953687-61953709 TCTCCAATGTAGAAGGGTGATGG + Intronic
956340096 3:68212773-68212795 TCAGAGTTGGAGAAAGGGGATGG + Intronic
956515926 3:70047788-70047810 TTTGCATGGCAGAAAGCGGAAGG + Intergenic
957450828 3:80379795-80379817 TCTTCATAGTGGAAAGGGGAGGG + Intergenic
957607800 3:82426122-82426144 TCTGAATGGTGGAAAGAGGAGGG - Intergenic
958047133 3:88299026-88299048 TCTGCATTGAAGAGAAGGTAGGG + Intergenic
959754513 3:109881980-109882002 TCTGCCTTGGAAAAATGGGAGGG - Intergenic
960150041 3:114239969-114239991 GCTGCATTTTGGGAAGGGGAGGG - Intergenic
961714625 3:128849930-128849952 TCTGCAGAGTCTAAAGGGGACGG - Intergenic
962112335 3:132466130-132466152 TCTGTACTGTTAAAAGGGGATGG + Intronic
962248432 3:133818949-133818971 TCTGGATAGCAGAAAGGGGAAGG + Intronic
963612393 3:147486479-147486501 TCTCCATTTTAGAAAGCAGATGG + Intronic
963757902 3:149255341-149255363 TCTGCAGTGTAGAGGTGGGAGGG + Intergenic
964538826 3:157756714-157756736 TCTACATTTTACAAAGTGGAAGG + Intergenic
964779153 3:160315829-160315851 TCTTTTTTTTAGAAAGGGGATGG + Intronic
965416476 3:168401099-168401121 TCAGCATTTTGGGAAGGGGAAGG - Intergenic
966515276 3:180813468-180813490 TCTGCCTTGTAAAAATGAGATGG + Intronic
968205064 3:196792158-196792180 TCTGCATAGAGGAAAGGTGAGGG + Intronic
968479792 4:828023-828045 CCTGGGTTGTAGAACGGGGAGGG - Intergenic
969675452 4:8611910-8611932 CCTGCATTGCAGATAGGAGAGGG - Intronic
970579175 4:17458520-17458542 TCTGCCTTATAGCAAGGGCAGGG + Intergenic
970763455 4:19518408-19518430 TCTCCAGTGTGGAAAAGGGAGGG + Intergenic
970865567 4:20755124-20755146 TCTGCACTGTAGTAATGAGATGG + Intronic
972267416 4:37475254-37475276 TATGAACTGTATAAAGGGGAGGG - Intronic
972852935 4:43072637-43072659 TCTGGACAGTAGAAAGAGGATGG + Intergenic
972885103 4:43476094-43476116 TCTGCATTTCAAAAAGGGAAGGG - Intergenic
972953648 4:44361610-44361632 TCTGCATTGTTGAAATGGTCTGG + Intronic
975086608 4:70348971-70348993 GCTGCATTTTAGCATGGGGAAGG - Intergenic
975639488 4:76485083-76485105 TCTGAATTGTTGAAACAGGATGG - Intronic
977000193 4:91488868-91488890 ACTGCATTGTAGTAAGGGTCAGG + Intronic
977399197 4:96510171-96510193 TCTGCCCTTTGGAAAGGGGAGGG + Intergenic
979797209 4:124861243-124861265 TTTGCATAGTAGAAAGGTCAGGG + Intergenic
980241844 4:130188285-130188307 TCTCCATGGTAGAAAAGGGGTGG - Intergenic
981541617 4:145852390-145852412 TGTGCATTCTTGAAAGGGCAAGG - Intronic
983115476 4:163810849-163810871 TCTGCTTTGTGGAAGGTGGATGG - Intronic
983253242 4:165368611-165368633 TCTGCATTGGAGTAAGTGGTTGG - Intronic
983577611 4:169275452-169275474 TCTGGATGGTAGGAGGGGGAGGG - Intergenic
986997363 5:13622242-13622264 TCTTCATAGGAGAGAGGGGAAGG - Intergenic
987662812 5:20899061-20899083 TGTGCATTGAAAAAAGGGTAGGG + Intergenic
988832555 5:35002284-35002306 TCTGTTTTGTTTAAAGGGGAAGG + Intronic
990495856 5:56347059-56347081 TCTGGATTTTAGGGAGGGGATGG - Intergenic
990660482 5:58009022-58009044 TCTGCATGGCAGAAAGGGAATGG - Intergenic
991219662 5:64198773-64198795 TCAACAATGAAGAAAGGGGAGGG + Intronic
991768072 5:70010458-70010480 TCTACATGGTAGAAATGTGAAGG - Intergenic
991847309 5:70885540-70885562 TCTACATGGTAGAAATGTGAAGG - Intergenic
992367018 5:76102574-76102596 TCAGCATTTTAGAAAGGAAAGGG + Intronic
994079713 5:95694820-95694842 CCTCCCTGGTAGAAAGGGGAGGG - Intronic
995599215 5:113777522-113777544 TCTGCAGTGCAGAAAAGGGGAGG + Intergenic
996165425 5:120216316-120216338 TCAGCATGGGAGAAAGAGGAAGG + Intergenic
996749648 5:126875712-126875734 TTTGCATTCTATAAAGGGCAGGG + Intronic
997383758 5:133456442-133456464 GCTACACTGAAGAAAGGGGAGGG - Intronic
998227476 5:140338088-140338110 CCTGCATTGTTCAAAGTGGAAGG - Intronic
998472859 5:142396868-142396890 TTTGCAATGCAGAAAGGGGGTGG + Intergenic
999024425 5:148210835-148210857 TCAGTAGAGTAGAAAGGGGAGGG + Intronic
999681642 5:154065764-154065786 TCAGCATTCTAGAGAGGGGAGGG - Intronic
1000028726 5:157383153-157383175 TCTGCATTCCAAAAATGGGATGG - Intronic
1000782848 5:165505316-165505338 GCTATATTGTAGAAAGGTGAGGG - Intergenic
1001332164 5:170770114-170770136 TCTGCATTTTAGAAAGAGGGTGG + Intronic
1001333461 5:170778638-170778660 TGTGCAGTGTAGCAAGAGGAAGG + Intronic
1001863601 5:175082732-175082754 TTTGCCCTGTAGAAAGGGCATGG + Intergenic
1003071934 6:2951733-2951755 TCTGCAGTGAAGAAGGGTGAAGG - Intronic
1005876515 6:30014014-30014036 TCTGAATTAAAGAAAGGGTAGGG + Intergenic
1006934466 6:37707771-37707793 CCCGCATTCTACAAAGGGGAAGG + Intergenic
1007947926 6:45842463-45842485 TTTGCATTAGGGAAAGGGGACGG + Intergenic
1008447969 6:51615754-51615776 ACTAAATTGTTGAAAGGGGAAGG + Exonic
1009850579 6:69192792-69192814 TCTGCATTAAAGTAAGTGGAAGG + Intronic
1010731063 6:79391761-79391783 TCTGTGTTCTAGAATGGGGAGGG + Intergenic
1011008102 6:82670889-82670911 TTTGCCTTGAAGAAAGGAGAAGG + Intergenic
1013401836 6:109804369-109804391 TCTTCATTGTACAAAAGGAATGG - Intronic
1013764422 6:113558236-113558258 TCTTCAGTGAAGAAAGGGAATGG + Intergenic
1013815166 6:114089164-114089186 TCTACCATGTAGAGAGGGGAAGG + Intronic
1015223367 6:130829723-130829745 TTTGGAATGAAGAAAGGGGAAGG - Intronic
1015578761 6:134701431-134701453 ACTCCTGTGTAGAAAGGGGAGGG - Intergenic
1017214314 6:151892672-151892694 TCTGCCTTGTGGAAAGAGAAAGG + Intronic
1017364863 6:153623579-153623601 TCTACTTTGTAGAAAGGAGAGGG - Intergenic
1018336100 6:162791743-162791765 ACTGCATTCTAGAAGGAGGATGG + Intronic
1018672481 6:166191278-166191300 TCTGCCTTCTGGAAATGGGATGG - Intergenic
1019173939 6:170150293-170150315 TCTGCATTGCAGGTAGTGGAGGG - Intergenic
1021333774 7:19372666-19372688 TCTGCAGTGTGAAAATGGGAAGG - Intergenic
1021667660 7:23002411-23002433 TCTTCATGGTAGAAAATGGAAGG - Intronic
1021795932 7:24254293-24254315 TCTCCATGGGAGAAGGGGGAAGG - Intergenic
1021931522 7:25585810-25585832 TCTGAATTGCAGAAAAGGGGTGG - Intergenic
1021939238 7:25663381-25663403 TATGCAGTGTTGAAAGGGGATGG + Intergenic
1021965568 7:25915046-25915068 GCAGCACTGTAGAATGGGGAGGG - Intergenic
1022726808 7:32988587-32988609 TTTGCATTGGAGAAAAGCGAAGG + Exonic
1022979786 7:35593743-35593765 AATGCAGTGTAGAAAGGGGAGGG - Intergenic
1022995918 7:35755437-35755459 TCTGCATGGTGTAAATGGGAGGG + Intergenic
1023623302 7:42093932-42093954 TCTGCATTGAAGAAGGGAGTTGG - Intronic
1023717479 7:43058715-43058737 TCTGTGTTGGAGAAAGGGAAGGG - Intergenic
1027775905 7:82463829-82463851 TCTGCCATGCAGAAAGGAGAGGG + Intergenic
1028884574 7:95917207-95917229 TCTGGATTGTGGACTGGGGACGG + Intronic
1031500624 7:122510697-122510719 GCTGCATTATTGAAAGGTGAAGG - Intronic
1032163694 7:129529531-129529553 TCTGCTTTGAACAAATGGGAAGG - Intergenic
1032489910 7:132316830-132316852 TCTGCATTGATGAAACTGGAGGG - Intronic
1033354378 7:140587596-140587618 TCTGTCTGGGAGAAAGGGGAGGG - Intronic
1033728002 7:144142277-144142299 TATGCATGGAAGAAAGGAGATGG - Intergenic
1036607134 8:10317505-10317527 TCTTCTTTGGAGAAAGTGGATGG + Intronic
1037228055 8:16619748-16619770 TCTCCATTGTAGGTAGGGGAAGG - Intergenic
1041433167 8:57807192-57807214 TCTGGATTGTTGAAATGAGAGGG + Intergenic
1041707547 8:60862460-60862482 TGTGTATTATAGAAGGGGGAGGG + Intronic
1043045320 8:75315573-75315595 TCTGAATTGAAGAAATGGCAAGG + Intergenic
1044429487 8:92091934-92091956 TCAGGAATGTATAAAGGGGAAGG - Intronic
1044590517 8:93909795-93909817 TCTACAGTGTAGCAAGAGGAGGG - Intronic
1044860293 8:96516246-96516268 TTTGCATTTTAGAGAGGGGAGGG - Intronic
1045362960 8:101449834-101449856 TCTGCATTCTGGACAGGGGTTGG - Intergenic
1045701636 8:104872997-104873019 GCTGCATTGAAGAATGGGGATGG + Intronic
1045856796 8:106773493-106773515 TATGAATAGTAGAAAGAGGAAGG + Intergenic
1046264022 8:111807364-111807386 TCTGCTTAGAAGAAAGGGGGGGG + Intergenic
1046654749 8:116880915-116880937 TCTGCATTCTGGAATGGCGAGGG - Intergenic
1048321831 8:133406041-133406063 TACGCATTGGAGAGAGGGGATGG - Intergenic
1048468248 8:134685177-134685199 TCTCCTCTGTAAAAAGGGGATGG - Intronic
1048974816 8:139665285-139665307 CCTGCTTTGAAGACAGGGGAAGG - Intronic
1050388107 9:5111539-5111561 TCTGCCATGTAGAAGGGGGCGGG - Intronic
1051511780 9:17886674-17886696 TTTACATTGTAAAAAGGGAAGGG - Intergenic
1051740809 9:20250151-20250173 TCTGTAATGTAGATAGGGAAAGG + Intergenic
1053573279 9:39331880-39331902 TCTGGATAGGAGAATGGGGAAGG + Intergenic
1053624636 9:39856112-39856134 TCTGTATAGGAGAATGGGGAAGG + Intergenic
1053880234 9:42587116-42587138 TCTGTATAGGAGAATGGGGAAGG - Intergenic
1053892430 9:42707210-42707232 TCTGTATAGGAGAATGGGGAAGG + Intergenic
1054094849 9:60890586-60890608 TCTGGATAGGAGAATGGGGAAGG + Intergenic
1054116316 9:61166490-61166512 TCTGGATAGGAGAATGGGGAAGG + Intergenic
1054123865 9:61287131-61287153 TCTGGATAGGAGAATGGGGAAGG - Intergenic
1054219260 9:62394586-62394608 TCTGTATAGGAGAATGGGGAAGG - Intergenic
1054231454 9:62514587-62514609 TCTGTATAGGAGAATGGGGAAGG + Intergenic
1054591443 9:67016054-67016076 TCTGGATAGGAGAATGGGGAAGG - Intergenic
1055397261 9:75889235-75889257 TGTACACTGGAGAAAGGGGAAGG - Intergenic
1055447240 9:76395115-76395137 TCTGCATTGCAGTAGAGGGACGG - Intergenic
1055995340 9:82151674-82151696 TCTTTATTGTAGAATGAGGAGGG + Intergenic
1057760158 9:97866463-97866485 TCTTCATTGTATAAAAGTGATGG + Intergenic
1060665983 9:125432421-125432443 TGTGCATTGCAGAAAAGGGCTGG - Intergenic
1061680203 9:132239263-132239285 TCTGCATTGGTGAGAGGGCACGG + Exonic
1061783519 9:133009323-133009345 TTTGCTTTTTAAAAAGGGGATGG + Intergenic
1185516293 X:701581-701603 TCTTCGATGTAGAGAGGGGACGG + Intergenic
1187438155 X:19291508-19291530 TCTGCAGTGGACAAAGGGGGAGG - Intergenic
1187553086 X:20325608-20325630 GCAGTATTGTAGAAAGGGCATGG + Intergenic
1189221177 X:39373564-39373586 GCTGCCTTGCAGCAAGGGGAAGG - Intergenic
1191865865 X:65703375-65703397 ACTGAATTTTAGAAAGAGGAAGG + Intronic
1194128257 X:90046663-90046685 AGTGCTTGGTAGAAAGGGGAAGG + Intergenic
1195912546 X:109903059-109903081 TCTGAATGGTGGTAAGGGGAAGG - Intergenic
1195962598 X:110401571-110401593 TCTGTGTTGTGGTAAGGGGAAGG + Intronic
1197894048 X:131292121-131292143 TCTCCATTGCAGAAAGGGATGGG - Intronic
1198004080 X:132474050-132474072 TCTAGATGGGAGAAAGGGGATGG + Intronic
1199036694 X:143059348-143059370 TCTTCATTTTAGAAAAGGAAGGG - Intergenic
1199137062 X:144266039-144266061 ATTGCAGTGTAAAAAGGGGAGGG - Intergenic
1200218658 X:154379875-154379897 GCGGCACTGGAGAAAGGGGAGGG + Intronic
1202173172 Y:22072571-22072593 TCTCCATTCTAGATATGGGAAGG - Exonic
1202218188 Y:22513800-22513822 TCTCCATTCTAGATATGGGAAGG + Exonic
1202324998 Y:23682255-23682277 TCTCCATTCTAGATATGGGAAGG - Intergenic
1202545773 Y:25987799-25987821 TCTCCATTCTAGATATGGGAAGG + Intergenic