ID: 923225985

View in Genome Browser
Species Human (GRCh38)
Location 1:231939416-231939438
Sequence AGTTCATTACAGATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923225985_923225991 21 Left 923225985 1:231939416-231939438 CCTTTCTCCATCTGTAATGAACT 0: 1
1: 0
2: 3
3: 24
4: 227
Right 923225991 1:231939460-231939482 TCCTTTGTAGGGCCCTTGAATGG 0: 1
1: 0
2: 0
3: 7
4: 130
923225985_923225988 9 Left 923225985 1:231939416-231939438 CCTTTCTCCATCTGTAATGAACT 0: 1
1: 0
2: 3
3: 24
4: 227
Right 923225988 1:231939448-231939470 GCCGTATCATTCTCCTTTGTAGG 0: 1
1: 0
2: 0
3: 10
4: 102
923225985_923225990 10 Left 923225985 1:231939416-231939438 CCTTTCTCCATCTGTAATGAACT 0: 1
1: 0
2: 3
3: 24
4: 227
Right 923225990 1:231939449-231939471 CCGTATCATTCTCCTTTGTAGGG 0: 1
1: 0
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923225985 Original CRISPR AGTTCATTACAGATGGAGAA AGG (reversed) Intronic
901501868 1:9657526-9657548 AGTTCATAAAAGTTGGGGAACGG - Intronic
906004668 1:42458017-42458039 AGGTCATTCCAGGTGGAGTATGG + Intronic
907492459 1:54816882-54816904 AACTCATAACAGATGGAGTAGGG + Intronic
907825912 1:58016741-58016763 AGCTTATTACAGATGGAGAATGG - Intronic
910894064 1:92049202-92049224 GGTACATTCCAGATGCAGAAAGG - Intronic
911268297 1:95770152-95770174 ACTTCTCTACAGATGGAGAGTGG - Intergenic
913969193 1:143401647-143401669 AGGTCATTGCAGAAGGAGAGAGG + Intergenic
914063570 1:144227246-144227268 AGGTCATTGCAGAAGGAGAGAGG + Intergenic
914115580 1:144739108-144739130 AGGTCATTGCAGAAGGAGAGAGG - Intergenic
916587468 1:166161026-166161048 AGCACATTTCAGATGGAGAGCGG + Intronic
917193783 1:172445707-172445729 ATTTCATCAAAAATGGAGAAGGG - Intronic
919208018 1:194442422-194442444 AGTTTATTATAGATGCAGAGTGG + Intergenic
919370647 1:196721785-196721807 AGTTCATTACACAATGATAAAGG - Intronic
920032335 1:203044932-203044954 ATTTCATTGCAGATGGGGTAGGG - Intronic
920819106 1:209363733-209363755 ACTTCCTTACAGAGGTAGAAAGG + Intergenic
921666335 1:217876509-217876531 AGTTCAGTGAAGATGGAGATAGG + Intergenic
923225985 1:231939416-231939438 AGTTCATTACAGATGGAGAAAGG - Intronic
924876521 1:248111058-248111080 AGTGGATTACAGATTGGGAATGG - Intergenic
1063378512 10:5569424-5569446 ACTTTATGACAGATGGAGAAGGG - Intergenic
1063507822 10:6617523-6617545 AGTGCTTTGAAGATGGAGAATGG + Intergenic
1064066291 10:12184936-12184958 AGTTAATTTCAGAAGGAAAATGG - Exonic
1064320772 10:14302625-14302647 ATTTCACTAAAGATAGAGAATGG + Intronic
1064665972 10:17651787-17651809 AGTTCATTAAAAATGGCCAATGG - Intronic
1066308486 10:34171305-34171327 AGTTCATCACACATAGAGAGAGG + Intronic
1068087796 10:52396368-52396390 AGTTGATGATAGAGGGAGAAGGG - Intergenic
1068965970 10:62912401-62912423 AGATCATTAGAAATGGACAATGG + Intronic
1072606257 10:96985275-96985297 AATGCATCTCAGATGGAGAAGGG + Exonic
1073926552 10:108522697-108522719 ATTACAGTACAGATGGAGAGAGG - Intergenic
1074145969 10:110717522-110717544 AGTTCATTCCAGATGGCCAGGGG - Intronic
1075513165 10:123088573-123088595 ATTCCATGACACATGGAGAATGG - Intergenic
1079418174 11:20260206-20260228 AGTTGATTAGACATGGAGAAGGG + Intergenic
1080909698 11:36583231-36583253 AGTTCCTGAAAGATGGAGAAGGG - Intronic
1080967979 11:37236041-37236063 AAATCATTACAGCTGTAGAAAGG - Intergenic
1085584956 11:77693528-77693550 TGATCATCCCAGATGGAGAATGG - Exonic
1085660833 11:78365327-78365349 AGGTCACTGCAGAAGGAGAAGGG - Intronic
1085674510 11:78503238-78503260 AGTTCAGCACAGATGCTGAATGG + Intronic
1090122206 11:124042491-124042513 AGTTCTTTGCACATGGAAAAAGG + Intergenic
1090383570 11:126343636-126343658 AGTGCATCCCAGATGGAGAAAGG - Intronic
1090611606 11:128476019-128476041 ATTTCATTACAGTTAGTGAATGG + Intronic
1091033685 11:132214169-132214191 AGATCATTAGTGATGGAAAATGG + Intronic
1091532926 12:1376825-1376847 GGTTCTTTACGGATGGAGAGGGG - Intronic
1091970801 12:4785369-4785391 AATTCATAAAAGATGGAAAAGGG - Intronic
1092100479 12:5879676-5879698 AGAGCATTTCAGATGGAGAGAGG + Intronic
1096087622 12:48876361-48876383 AGTTCAATATAGCTGGAGAGAGG - Intergenic
1097738272 12:63208041-63208063 TGGTCATAAAAGATGGAGAAGGG + Intergenic
1099841062 12:87967956-87967978 AGAGTATTTCAGATGGAGAATGG - Intergenic
1100801603 12:98237266-98237288 AGTACATTACATTTGGAGAGAGG + Intergenic
1102150319 12:110685253-110685275 AGTGCTTTAAAGATGGAGGATGG + Intronic
1103423967 12:120815011-120815033 AGTTCCTTACAGGTGGACACTGG + Intronic
1104549134 12:129739845-129739867 TGTTAATTACCAATGGAGAAGGG - Intronic
1106769143 13:32944907-32944929 AGTTCATTTCAGATGCTGAAAGG + Intergenic
1109240782 13:59884755-59884777 AGTTCATTTCACTTGGAGAAAGG + Intronic
1110521169 13:76478541-76478563 AGTTGTTCACACATGGAGAAAGG - Intergenic
1111029666 13:82578858-82578880 AGGTCATTACATAAGGATAAAGG - Intergenic
1111196591 13:84882509-84882531 AGTACATCACAGCTGGAGGAAGG - Intergenic
1111297326 13:86297642-86297664 AGTTCATCCCTGGTGGAGAAAGG - Intergenic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1111775678 13:92658807-92658829 AGTGCAATACAGCTGGAGCAAGG + Intronic
1112197308 13:97238530-97238552 AGTTCAATAAAGATGAAGACCGG + Intronic
1112490108 13:99855173-99855195 AGTTCATTCCACAGTGAGAATGG + Intronic
1112631832 13:101170034-101170056 AGTTCATTCCAGATTGAGGGCGG - Intronic
1117534091 14:56687722-56687744 AGTACATTGCAGATGGAGTAGGG + Intronic
1117846380 14:59915816-59915838 AGGTCATTACAAATATAGAAAGG - Intergenic
1122038698 14:98966697-98966719 AGTTCACTTCAGAGGGAGGATGG + Intergenic
1124376261 15:29130929-29130951 AGCTCCTTACAGAAGGAGAGCGG + Intronic
1124397547 15:29317534-29317556 AGTTCATCACATATGCAAAACGG + Intronic
1124969440 15:34471437-34471459 AGTGCATTACAGCTGGAGCAAGG + Intergenic
1126938962 15:53744624-53744646 TGTACATTACAGCTGGAAAAAGG + Intronic
1128133158 15:65244075-65244097 AGATCTTACCAGATGGAGAAAGG - Intronic
1128361271 15:66963415-66963437 AGTTCATTACACATGAGGAAGGG - Intergenic
1129508443 15:76102489-76102511 AGAGCATTCCAGGTGGAGAAAGG + Intronic
1129754107 15:78085594-78085616 TGCTCATGACAGCTGGAGAAGGG - Intronic
1130682538 15:86009282-86009304 AATTCTCTAGAGATGGAGAATGG - Intergenic
1130843022 15:87719433-87719455 AGTTCTTTTAAGATGGACAAAGG + Intergenic
1130858062 15:87859097-87859119 AGTTCAACAGAGATGTAGAAAGG - Intergenic
1131563428 15:93463782-93463804 AATTCATTTCAAATGGAGACAGG + Intergenic
1132189855 15:99844002-99844024 AGTGCATTACAGCTGGAGCAAGG - Intergenic
1133454326 16:5930046-5930068 ATTTCAGTACAGCTGGAGAATGG + Intergenic
1133619286 16:7510975-7510997 AGTAAATTCCAGATGCAGAAAGG + Intronic
1137614360 16:49838140-49838162 AGTAAATTACAGATGAAGATTGG - Intronic
1138219778 16:55240745-55240767 GGCTCATTTCAGATGAAGAATGG - Intergenic
1139021499 16:62755604-62755626 ATTTCTTTAGAGATGGAGATTGG + Intergenic
1139746453 16:69078476-69078498 AGTTCACTGGAGATGGCGAATGG - Intronic
1149766649 17:59284356-59284378 AGTTCATAACAGGTGGGGATGGG + Intergenic
1150826950 17:68485214-68485236 AGCTCAAGACAGATGGAGAGTGG + Intergenic
1151924256 17:77182586-77182608 AGTTCCTCAGAGAGGGAGAAAGG - Intronic
1153417132 18:4858617-4858639 AGTTCATTACATATTGTCAAGGG - Intergenic
1153682733 18:7515769-7515791 ATTTCATTAGAGTGGGAGAAGGG + Intergenic
1154261237 18:12834809-12834831 AGAACAGTACAGAGGGAGAAAGG + Intronic
1154319648 18:13337087-13337109 AGTGCATCAGAGATGGAGAGAGG - Intronic
1155415507 18:25594873-25594895 AGTTCATTTGAGATGAAGACAGG - Intergenic
1155784256 18:29877406-29877428 TGTTGATTACAGATTGGGAATGG - Intergenic
1157812789 18:50709563-50709585 AGCTCATTCAAGATGGAGATTGG + Intronic
1158164846 18:54528845-54528867 GGATCATTACAGTTGGAGACTGG - Intergenic
1158215891 18:55100303-55100325 AGGTCATGACAGACAGAGAAAGG + Intergenic
1158880904 18:61778921-61778943 AGTTCCTTATAGATGGGGAGGGG + Intergenic
1159901409 18:74050690-74050712 AGTTCATTACAGTTTGCCAAGGG - Intergenic
1163253900 19:16143385-16143407 ACATCATTACAAAGGGAGAACGG - Intronic
1166165016 19:40981315-40981337 AGGTGGTTTCAGATGGAGAAGGG - Intergenic
925616471 2:5748687-5748709 AGTCCAGGGCAGATGGAGAAAGG - Intergenic
925687212 2:6484406-6484428 TGTGGATTACAGATTGAGAATGG + Intergenic
928061702 2:28120029-28120051 AGTTAATTAAGGAAGGAGAATGG - Intronic
929012410 2:37458088-37458110 ATGTCATTACACATGGAGAAAGG - Intergenic
929315102 2:40467427-40467449 TATTCAGTACAGATGGAGAGAGG + Intronic
930082833 2:47468043-47468065 AGAACAGTACAGAAGGAGAAAGG - Intronic
931882931 2:66585746-66585768 ACTTCATTACAGGAGGACAATGG + Intergenic
932809272 2:74810655-74810677 AGTGCATTCCAGGTTGAGAATGG + Intergenic
934173886 2:89562551-89562573 AGGTCATTGCAGAAGGAGAGAGG + Intergenic
934284200 2:91636900-91636922 AGGTCATTGCAGAAGGAGAGAGG + Intergenic
936176004 2:110220532-110220554 ATTTGATTTCAGCTGGAGAATGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
939167117 2:138652026-138652048 AGATCATTACAGCTGCAGAGTGG + Intergenic
939179097 2:138783214-138783236 TGTTTAGTACAGCTGGAGAAAGG + Intergenic
939524827 2:143279879-143279901 AGCTCATTACAGATAGAGATGGG + Intronic
939569929 2:143829162-143829184 ATTTCCATACAGATGGAAAAGGG + Intergenic
940700340 2:157033233-157033255 TGCTCATTAAAGATGGAGCAAGG + Intergenic
943767763 2:191679794-191679816 AAGTCATTAAAAATGGAGAAGGG - Intronic
945283823 2:208062407-208062429 AATTCATTCCAGATGTGGAAAGG - Intergenic
945567826 2:211425260-211425282 AATTCATTACAGATGGCAATAGG - Intronic
946631223 2:221671420-221671442 AGTAAATTTCTGATGGAGAAAGG + Intergenic
946645224 2:221826142-221826164 AGTTCTTGACAGATGGAAAAGGG - Intergenic
1169826038 20:9769815-9769837 AGGTCATATCAGATGGAGAATGG - Intronic
1170805417 20:19625946-19625968 AATTCAATAAAGGTGGAGAAAGG - Intronic
1173450100 20:43156378-43156400 AGTTAATGACAGAAGGAGACTGG + Intronic
1173500496 20:43549451-43549473 AGTGCAAGACAGATGGAGAGCGG - Intronic
1179364351 21:40742361-40742383 ATTTGTTTAAAGATGGAGAAAGG + Intronic
1181661604 22:24354363-24354385 AATTCCTTACAGATGGAATAAGG - Intronic
1182187102 22:28416468-28416490 AGTTCTTTAGGGATGGAGATGGG - Intronic
950226103 3:11235697-11235719 ACTTCATTACAGCTTGACAAGGG + Intronic
951159610 3:19401393-19401415 AGTTTATTTCTGATGGACAAAGG + Intronic
952227053 3:31388917-31388939 AGATCAGTAAACATGGAGAAAGG - Intergenic
952784657 3:37141382-37141404 AGTTCAGTATAGCTGGAGAGGGG - Intronic
955201665 3:56857252-56857274 AGTTCCTTAAAGAGGGAGAAAGG - Intronic
955728262 3:61956003-61956025 AGTTCATTATTTCTGGAGAAAGG + Intronic
956217484 3:66863517-66863539 GGTTCATTTCAGGTGAAGAAAGG + Intergenic
957032458 3:75257418-75257440 AGTCCATTGCAGATGGGTAAAGG + Intergenic
957276573 3:78097599-78097621 AGTTCATGACACATGGACACAGG - Intergenic
960453816 3:117844647-117844669 TGTTCCTTACAGAAGCAGAAAGG + Intergenic
961955370 3:130796773-130796795 AGTTCATTACATAATGATAAAGG - Intergenic
962543505 3:136408078-136408100 AGTTAAATACAGAAGGATAAAGG - Intronic
963018433 3:140848437-140848459 GGATTATTACAGATGGATAAGGG - Intergenic
964713508 3:159696878-159696900 AGTTCATTATTAATGGAGAAAGG + Intronic
967844721 3:194034662-194034684 ACTGCATTACAGAAGAAGAAAGG + Intergenic
971103564 4:23497089-23497111 AGGTACTTACAGATGAAGAAGGG + Intergenic
973135750 4:46704402-46704424 AATTCATTGCAGATGGAGAAGGG + Intergenic
973765735 4:54160410-54160432 ATTTCATGACAGAAGGTGAAAGG - Intronic
974529901 4:63094979-63095001 ATTTCATTACACATTGAGACTGG - Intergenic
974715470 4:65664697-65664719 AGTATATTTCAGGTGGAGAATGG - Intronic
975929696 4:79504779-79504801 AGATCATAGCTGATGGAGAAGGG - Intergenic
976132056 4:81895151-81895173 AGTTCACTACTGTTGGAGAATGG + Intronic
976530446 4:86146157-86146179 AGTGAATAACAGATGTAGAAAGG + Intronic
976650879 4:87433327-87433349 AGGTCATGAAAGATAGAGAAAGG - Intronic
976691612 4:87873907-87873929 AATTCATTAGAGTTGCAGAATGG - Intergenic
976804427 4:89030103-89030125 TGGTCATTATAGATGAAGAATGG - Intronic
977247930 4:94655985-94656007 AGTTCACTACTGAAGGACAATGG - Intronic
978456210 4:108895254-108895276 ACTACAGTACAGATGGATAATGG - Intronic
978841224 4:113215285-113215307 CCTTCTTTACAGATGGGGAATGG - Intronic
979195759 4:117917917-117917939 CATTGATTACAAATGGAGAAGGG - Intergenic
980130734 4:128813185-128813207 ATTTAATCACAGGTGGAGAAAGG + Intronic
980317577 4:131222475-131222497 AGTTTCTCACTGATGGAGAAAGG + Intergenic
981015126 4:139966375-139966397 AGTTCCTAACATCTGGAGAATGG - Intronic
981471945 4:145145814-145145836 AGTGCCTGACACATGGAGAAAGG + Intronic
982266924 4:153546233-153546255 ATTATCTTACAGATGGAGAAGGG + Intronic
982357344 4:154485436-154485458 AGGTCAGAACACATGGAGAAGGG + Intronic
983476776 4:168221671-168221693 AATTCATTAGAGATGGAGATGGG + Intronic
983663065 4:170151361-170151383 AGTCCATTACATATGATGAAGGG - Intergenic
983929109 4:173433994-173434016 AGTTTATTACAGATGTTGAAAGG - Intergenic
984190207 4:176596510-176596532 AGTTTCTTACACAAGGAGAAGGG - Intergenic
984278933 4:177643830-177643852 AGTTGAAGACAGATGGTGAATGG - Intergenic
984945121 4:184964978-184965000 ATTCCATTACAGATTGAGACAGG - Intergenic
985831392 5:2235354-2235376 AGATCAAAACAGATGAAGAAGGG - Intergenic
986408253 5:7448263-7448285 AATACATTAAAGATGCAGAAGGG + Intronic
986497984 5:8365956-8365978 AGTTCATAACAGATTATGAAAGG - Intergenic
987452335 5:18101533-18101555 AGTTCAGTAGAGATGGCAAAAGG + Intergenic
990542097 5:56783346-56783368 AGTTCATTACAAATGTAGCCTGG + Intergenic
990768450 5:59214720-59214742 AGTTGTTTAGAGATGAAGAAGGG + Intronic
992781507 5:80132303-80132325 AGTTCCTTACAGAAGCAGGAGGG - Intronic
993492150 5:88565467-88565489 ATTTCACTAGAGCTGGAGAAGGG - Intergenic
995366403 5:111366500-111366522 TGGTAATTACAAATGGAGAAAGG - Intronic
995554392 5:113312539-113312561 AGGTCAATGCAGCTGGAGAATGG + Intronic
995981704 5:118112285-118112307 AAATCATCACAGAAGGAGAAAGG - Intergenic
996053837 5:118963414-118963436 AGTTCAGTGTAGCTGGAGAAAGG + Intronic
997135005 5:131315901-131315923 AGTTAATTATAGATGGGGGAGGG + Intronic
997247470 5:132362620-132362642 AGTTCTCTACAGATGGATGATGG + Intergenic
998609879 5:143676603-143676625 ACTTAATTATAGATGGATAAGGG + Intergenic
999555054 5:152731277-152731299 AGTGCAATACAAATGGAGGAAGG - Intergenic
1000837872 5:166178275-166178297 AATTCATTACAGAGGCAGAGAGG - Intergenic
1000953680 5:167516436-167516458 ATTCCATTAGAGATGGAAAAAGG - Intronic
1004607503 6:17207534-17207556 AGCTGATGACAGATGGAGCAAGG + Intergenic
1006713064 6:36092567-36092589 AGTTAATTTCAGAAGGAAAATGG - Intronic
1009405725 6:63310087-63310109 AGTTTTGTACAGATGGAGATAGG - Intronic
1009564188 6:65290215-65290237 AGTTTAGTAAAGATGGAGAAAGG + Intronic
1009598672 6:65769675-65769697 ACTTCATTACTAATGGAAAATGG - Intergenic
1009828073 6:68893158-68893180 AGTTTATTAGAGAAAGAGAAAGG + Intronic
1009828993 6:68905310-68905332 AGTTCATGTCAGCTGGAAAAAGG - Intronic
1010250446 6:73701730-73701752 AATTCATTAATGAGGGAGAAAGG - Intronic
1010819347 6:80395391-80395413 AGGTGATGTCAGATGGAGAAGGG + Intergenic
1011012873 6:82721788-82721810 AGCTCAGTACAGTTGGAGCAGGG - Intergenic
1013760097 6:113508252-113508274 AGTCCATGACAGATGGAGAGAGG + Intergenic
1014144481 6:117981398-117981420 AGAACATTTAAGATGGAGAAGGG + Intronic
1015318672 6:131846563-131846585 AGTTGTTTAAAGAAGGAGAAAGG - Intronic
1019119548 6:169792352-169792374 AGCTCACAACAGATTGAGAAGGG + Intergenic
1020663788 7:11014043-11014065 AGTGGGATACAGATGGAGAAGGG + Intronic
1021938772 7:25658207-25658229 TGTGAAGTACAGATGGAGAAAGG - Intergenic
1026625439 7:71987892-71987914 AGTGCAGGACAGATGGGGAAGGG + Intronic
1027980452 7:85213612-85213634 ATTTCTTCACAGATGGATAAAGG + Intergenic
1028830275 7:95320259-95320281 GGTTCACAAAAGATGGAGAAAGG + Intronic
1031115495 7:117663385-117663407 AATTCATTAAAGTTTGAGAAGGG - Intronic
1031275726 7:119720760-119720782 AATTCAGAACAGATGGAGGAAGG - Intergenic
1032334861 7:131016040-131016062 AGTCCATTACAGAAGGAGAAAGG + Intergenic
1033784476 7:144714204-144714226 AGTTTATTAGAAATGCAGAAGGG - Intronic
1033877414 7:145839754-145839776 AGATCATTACAGAATGATAAAGG - Intergenic
1034105438 7:148485977-148485999 TATTCATTACAGATGGCTAAAGG + Intergenic
1034885089 7:154793199-154793221 ATCTCATTATAGATAGAGAAGGG + Intronic
1036044707 8:5126877-5126899 AGTCCTTTACAGATGGAGTCAGG + Intergenic
1036524243 8:9520287-9520309 AGTACATTACAGATGCACTAGGG + Intergenic
1037020989 8:13969836-13969858 AGTTCATTGCAAAGGGCGAAGGG + Intergenic
1040030844 8:42822159-42822181 AGTGCATTGAAGATGGGGAAGGG + Intergenic
1043186242 8:77154210-77154232 AGCTCATCAGAGATGGGGAACGG - Intergenic
1044206503 8:89497067-89497089 ATTTTTTTACAGATGGGGAAAGG - Intergenic
1044252580 8:90021443-90021465 ATGTCATTAGAGATGGGGAAAGG + Intronic
1044879001 8:96702772-96702794 ACTTGTTTACAGAAGGAGAAAGG - Intronic
1045677587 8:104625246-104625268 AGTACATTTCAGATAGAAAAGGG + Intronic
1047132199 8:122034076-122034098 TGTTCATTCCAGATAGAAAAGGG - Intergenic
1047663808 8:127067628-127067650 AGATTATTACAGAGGGGGAAGGG + Intergenic
1051016047 9:12476355-12476377 AAATCATGACAGATGGTGAAGGG - Intergenic
1052470229 9:28884570-28884592 AATTATTTACAGATGGACAAAGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1056207083 9:84329998-84330020 AGTTCATTACAGTAGAAGATTGG - Intronic
1058129149 9:101230034-101230056 AGATCATTACAGATGTATACAGG + Intronic
1058782444 9:108351895-108351917 AGATCAATACAGAAGGAGATAGG - Intergenic
1058832997 9:108836093-108836115 ATTTCATTACTGTTGAAGAAGGG + Intergenic
1059953030 9:119487570-119487592 ATTTTATTACAGAAGAAGAAAGG - Intergenic
1060135871 9:121153299-121153321 GGTGGATTTCAGATGGAGAAGGG - Intronic
1060262572 9:122089382-122089404 ACCTCATAACAGATGGGGAAAGG + Intronic
1061423330 9:130483968-130483990 GGAACATTCCAGATGGAGAATGG + Intronic
1062149907 9:135012679-135012701 AGGTCATCACAGATGGGGAAAGG - Intergenic
1062436739 9:136549711-136549733 AGTTCTTTATAAGTGGAGAAAGG - Intergenic
1185864436 X:3610589-3610611 AATGCATACCAGATGGAGAAAGG + Intronic
1186741334 X:12521400-12521422 AATCCATTGCAGATGGGGAAAGG - Intronic
1187299204 X:18031576-18031598 TGGTCATTAGAGATGGAGACAGG - Intergenic
1187647679 X:21366792-21366814 AGTGTATGAGAGATGGAGAATGG - Intergenic
1188193708 X:27204206-27204228 ATATCATTACAGATGGAGTAGGG - Intergenic
1190924789 X:54893652-54893674 AGTTCAGTAGAGATGGTAAAAGG - Intergenic
1191233651 X:58117161-58117183 GGTTTGTTACAGATAGAGAATGG - Intergenic
1191984379 X:66963137-66963159 AGTTCATTATATATTGACAAAGG - Intergenic
1194768374 X:97870139-97870161 AGTTCGTTGTAGTTGGAGAAAGG + Intergenic
1195641981 X:107185440-107185462 ATTACATTACAAATGGGGAAGGG + Intronic
1196545128 X:116954362-116954384 AGTTCCTTTCATATTGAGAAGGG + Intergenic
1198247598 X:134845889-134845911 AGTTCATAAATTATGGAGAAGGG - Intronic
1198825310 X:140692509-140692531 ATTTCATTTGAGATGGAGTAGGG - Intergenic