ID: 923226103

View in Genome Browser
Species Human (GRCh38)
Location 1:231940178-231940200
Sequence TCTTTACCACACACAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923226103_923226107 24 Left 923226103 1:231940178-231940200 CCTCTCTCTGTGTGTGGTAAAGA 0: 1
1: 0
2: 0
3: 16
4: 199
Right 923226107 1:231940225-231940247 ACCAGTTTGCACGGTTCTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 65
923226103_923226106 15 Left 923226103 1:231940178-231940200 CCTCTCTCTGTGTGTGGTAAAGA 0: 1
1: 0
2: 0
3: 16
4: 199
Right 923226106 1:231940216-231940238 AATTCTCTCACCAGTTTGCACGG 0: 1
1: 0
2: 1
3: 21
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923226103 Original CRISPR TCTTTACCACACACAGAGAG AGG (reversed) Intronic
901023039 1:6264697-6264719 TGTGGACCACACACAGAGACAGG + Intronic
901944725 1:12692423-12692445 TCTTAACCACACCAACAGAGAGG - Intergenic
903416335 1:23185797-23185819 TATATACCACAGTCAGAGAGTGG - Intergenic
904376291 1:30084476-30084498 TCTTTGCCAGACACTCAGAGGGG - Intergenic
908666176 1:66493673-66493695 TCTTAAGCAGACCCAGAGAGGGG + Intergenic
910033144 1:82756398-82756420 TCTTATCCATACACAGAGAGAGG + Intergenic
911284753 1:95975592-95975614 GGTTTACCCCACACAGAAAGAGG + Intergenic
914702372 1:150146998-150147020 TCTTCACCACAGACAGAAACTGG + Intergenic
916325594 1:163556346-163556368 ACTTAACCACACACAGAGCCAGG - Intergenic
918522338 1:185428660-185428682 TCTTTGCCCCACACATATAGTGG - Intergenic
922078164 1:222268367-222268389 TCTTTACCCCAAGGAGAGAGAGG + Intergenic
923226103 1:231940178-231940200 TCTTTACCACACACAGAGAGAGG - Intronic
923277589 1:232411744-232411766 TCTGGACTACACCCAGAGAGAGG - Intronic
924624093 1:245685900-245685922 TCCTTATCAGACTCAGAGAGTGG - Exonic
924800252 1:247324467-247324489 TTTTCACCACACACAGAAAAAGG + Intronic
1063424244 10:5939094-5939116 TCTTTAACACATTCAGAGAATGG + Intronic
1065708575 10:28493981-28494003 TTTTTCTCACACAAAGAGAGAGG - Intergenic
1068103341 10:52582781-52582803 TAATTACCACACACTGTGAGAGG - Intergenic
1070047390 10:72852086-72852108 TCTTTTTCACATACAGAAAGGGG + Intronic
1070084040 10:73217753-73217775 TCTTGCCCACACTCAGAGTGGGG + Intronic
1070268695 10:74930649-74930671 TATTTAACACATACAGAGAGTGG - Intronic
1070823906 10:79379961-79379983 TCTGCTCCAGACACAGAGAGGGG - Intergenic
1073251643 10:102123493-102123515 ATTTTACCACACACATACAGAGG - Intergenic
1073907552 10:108300676-108300698 CTTTTACCACACCCTGAGAGTGG + Intergenic
1078156652 11:8805717-8805739 TCTTAATCACACAGACAGAGTGG + Intronic
1078703560 11:13715729-13715751 TCTTTACCACACAATTACAGTGG + Intronic
1081665876 11:44916820-44916842 TCTCTGGCACACACAGAGACTGG - Intronic
1081963824 11:47157512-47157534 ACTTTTCTACACAAAGAGAGGGG + Intronic
1083618518 11:64037679-64037701 TCTTTCCCAGACACAGAGACTGG + Intronic
1086909077 11:92451198-92451220 TCTTCACCACACAAGGCGAGTGG - Intronic
1092021414 12:5205744-5205766 TCTTGAGCACACTCAGAGATGGG - Intergenic
1092523859 12:9297763-9297785 TCTCTCTCACACACACAGAGTGG + Intergenic
1092543439 12:9434136-9434158 TCTCTCTCACACACACAGAGTGG - Intergenic
1094417923 12:30236777-30236799 TGTTTGCCACACACAGTGACTGG - Intergenic
1094509507 12:31087920-31087942 TCTCTCTCACACACACAGAGTGG + Exonic
1095491833 12:42743186-42743208 TCCTTACAACCCACATAGAGGGG + Intergenic
1095707378 12:45251780-45251802 ACTCTACCACACACAGTGAATGG - Intronic
1097278810 12:57831727-57831749 TCTTTTCCCCACAAAGACAGAGG - Intronic
1100680207 12:96910396-96910418 TTTTCATCACACACACAGAGAGG - Intronic
1101781123 12:107837123-107837145 TCTTTAGAAGACAAAGAGAGTGG + Intergenic
1102061107 12:109931694-109931716 TCTGAACCACACACACAGAATGG + Exonic
1105683095 13:22749982-22750004 TCTTTACCACACTGAGAAAGTGG - Intergenic
1106120965 13:26859894-26859916 CCATGACCACACACAGAGGGTGG - Intergenic
1106217715 13:27718121-27718143 TCATGACCACACTCAGAGACAGG + Intergenic
1106500107 13:30320001-30320023 TCCTGACAACACACAGAGACTGG - Intergenic
1107905223 13:45055329-45055351 TCTTTATCACACTCAGAAACCGG - Intergenic
1108003541 13:45925834-45925856 CCCTTACCACACACACAGAATGG - Intergenic
1108131508 13:47306481-47306503 GCTTTACCACACACACAGCCAGG - Intergenic
1108174377 13:47777322-47777344 TCCTGACCACAGACAGAAAGGGG + Intergenic
1108427581 13:50319367-50319389 ACTTTTCCACAGACACAGAGTGG - Intronic
1109424771 13:62154827-62154849 TCTTTATAAGTCACAGAGAGAGG + Intergenic
1111022907 13:82478363-82478385 GCTTTATCACACACACAGAGAGG + Intergenic
1111901009 13:94199818-94199840 CCTTGACCACACACAGAAACTGG + Intronic
1111915055 13:94352068-94352090 TCGTTAACACAGACAGAGAGAGG - Intronic
1113310358 13:109125966-109125988 TCTTCATCATTCACAGAGAGAGG - Intronic
1113894341 13:113754264-113754286 TATTTCCCACACACAAGGAGAGG + Intergenic
1115514319 14:34170157-34170179 TTTATACAACACAGAGAGAGGGG - Intronic
1115811185 14:37109572-37109594 TCTTTACCTGTCACAGAGAGTGG + Intronic
1117228156 14:53685312-53685334 GCTTCAACATACACAGAGAGAGG - Intergenic
1117897527 14:60503411-60503433 TCTGTATCACACACAAATAGTGG - Intronic
1121174933 14:91883920-91883942 TCTTCATCACACACAGAGTTTGG + Intronic
1123178335 14:106443119-106443141 ACTGTACCAGACACAGTGAGAGG - Intergenic
1126132808 15:45359421-45359443 TCCCTCCCACACACACAGAGCGG + Intergenic
1127489127 15:59445586-59445608 TTTTTCACACACTCAGAGAGAGG - Intronic
1131202591 15:90412576-90412598 TCTTCACCATACGCAGAAAGAGG - Intronic
1134513844 16:14870779-14870801 AGTTTACCATCCACAGAGAGGGG - Intronic
1134701487 16:16269274-16269296 AGTTTACCATCCACAGAGAGGGG - Intronic
1134970344 16:18525371-18525393 AGTTTACCATCCACAGAGAGGGG + Intronic
1135939737 16:26810608-26810630 TCTTTACCACACCCTCTGAGGGG - Intergenic
1136186032 16:28589490-28589512 GCTTTACGACACACAGCGTGTGG - Intronic
1137933455 16:52610286-52610308 GCTTTACTGCAGACAGAGAGTGG + Intergenic
1138627856 16:58266723-58266745 TCTTCCCCACTGACAGAGAGTGG + Intronic
1139541916 16:67624362-67624384 TCTTCACTACATTCAGAGAGTGG - Intronic
1142055071 16:87988892-87988914 TGATTTCAACACACAGAGAGGGG - Intronic
1144330967 17:14223866-14223888 TCTTTACATCACAAAGGGAGAGG - Intergenic
1154107246 18:11533678-11533700 TCTCTGCAACACAGAGAGAGAGG - Intergenic
1154357224 18:13630992-13631014 TCCTTTCCACACACACACAGAGG - Intronic
1156602771 18:38629950-38629972 TCTTTTCCACACAAAGATATTGG - Intergenic
1157157738 18:45284405-45284427 ACATTGCCAAACACAGAGAGGGG - Intronic
1167722316 19:51187048-51187070 GCTTTCCCAGACACAAAGAGCGG - Intergenic
1168120308 19:54248333-54248355 TCTATTTCACACACACAGAGGGG - Intronic
926219792 2:10927216-10927238 TTTTTAACACACACACAGACAGG + Intergenic
926855048 2:17246543-17246565 TCTTAACTGAACACAGAGAGAGG - Intergenic
926928104 2:18008739-18008761 CCTTTCCCACTAACAGAGAGCGG - Intronic
928108670 2:28489312-28489334 TCTGTACCACAGCCAGGGAGTGG - Intronic
928264278 2:29798217-29798239 TCTCTCACACACACAAAGAGAGG - Intronic
928595047 2:32852249-32852271 TCTTTACAAGGCACAGAGAATGG + Intergenic
928887933 2:36171277-36171299 TCTTTTCCATACTCAAAGAGAGG - Intergenic
929097476 2:38277774-38277796 TCTTTTCCCCACAAAGTGAGAGG - Intergenic
932583660 2:73008776-73008798 TCTTTGCCACACACCGAAGGGGG + Intronic
932689091 2:73897231-73897253 TGTTTCCCACACACAGAAAGAGG - Exonic
934639660 2:96020104-96020126 CATTGACCACACACAGTGAGGGG + Intergenic
934793986 2:97085273-97085295 CATTGACCACACACAGTGAGGGG - Intronic
935742484 2:106162006-106162028 TCTTTATCACACACTGAGTCAGG + Intronic
936245357 2:110821460-110821482 TCTGAGCCACACACAGAGAAGGG - Intronic
936771565 2:115920097-115920119 TCTTTCCTACAGAGAGAGAGGGG + Intergenic
937980534 2:127612073-127612095 GCTTTACCACACACACATACAGG - Intronic
938702906 2:133894939-133894961 TCTTAACTACAAACAGAGAGGGG - Intergenic
941827961 2:169920825-169920847 CCTCAACCACACACAGAGATTGG - Intronic
941950178 2:171147602-171147624 TCTTTGCCACATAAACAGAGAGG - Intronic
942834654 2:180279199-180279221 TCTTTACAATACACAGAGATTGG + Intergenic
944627358 2:201584936-201584958 TATATAACACACACAGAAAGAGG + Intronic
945688437 2:213002211-213002233 CCTTTATCCCATACAGAGAGTGG - Intronic
947489277 2:230579829-230579851 TCTGTAGCACACACAGAAGGGGG - Intergenic
1168792592 20:589695-589717 TCTTTGCCACCAAAAGAGAGAGG + Intergenic
1168984297 20:2034792-2034814 TGTGTTCCACACACAGAGAAAGG - Intergenic
1169419223 20:5445918-5445940 TGGTTACCACACACAGAAATTGG + Intergenic
1170052714 20:12164316-12164338 TCTTTACACCACACAGACACTGG - Intergenic
1170449088 20:16463160-16463182 TCTTTCCTGCAGACAGAGAGGGG - Intronic
1172469336 20:35179895-35179917 TGTTTACCACAAAGAAAGAGAGG - Intergenic
1174003644 20:47392977-47392999 GCTTAACCACCCACAGAGAAAGG - Intergenic
1175154281 20:56958976-56958998 TCTTCACAACACCCAGAGAGGGG + Intergenic
1175291681 20:57880149-57880171 TCTTTTCCCCCCAAAGAGAGAGG - Intergenic
1175603571 20:60294835-60294857 CCTTTACAGCACACACAGAGTGG - Intergenic
1175668213 20:60878365-60878387 TCTATGCCACACATAGAGACCGG + Intergenic
1175925523 20:62469451-62469473 CCCTTAGCACACACAGATAGGGG + Intronic
1177088799 21:16740424-16740446 TATTTACAACACATAGAGAAAGG + Intergenic
1177314728 21:19443320-19443342 ACTTTACCAGAAAGAGAGAGGGG + Intergenic
1178149638 21:29779559-29779581 TCTTTACCACCCACAAAAAGTGG + Intronic
1180195805 21:46193174-46193196 TCTGTGCCACACACAGACATAGG - Intronic
1180195840 21:46193652-46193674 TCTGTGCCACACACAGACATAGG - Intronic
1182932843 22:34191490-34191512 TATTTAACACAGACACAGAGAGG + Intergenic
1183716926 22:39538514-39538536 CCTTGACCCCACACAGGGAGCGG - Intergenic
1183818656 22:40325642-40325664 ACTTTGCTCCACACAGAGAGCGG - Exonic
1185419454 22:50727415-50727437 TCATTGCCACACACAGAGCCTGG - Intergenic
949636465 3:5987320-5987342 GATTTAAAACACACAGAGAGAGG - Intergenic
950117001 3:10457434-10457456 TCTTTCCCACACACAAAGCACGG - Intronic
952736523 3:36696924-36696946 TCTTTCTCACAGACAGAGATGGG + Intergenic
953617904 3:44508409-44508431 TCTTCACCACACCCAGAGGAGGG + Intronic
953918235 3:46934360-46934382 TCTTTTCCCCACACAGGGAGGGG + Intronic
957346357 3:78966200-78966222 ATTTTTCCACAGACAGAGAGGGG - Intronic
958682167 3:97344856-97344878 TCTGAGACACACACAGAGAGAGG + Intronic
961822338 3:129581504-129581526 TCTGGCCCACCCACAGAGAGTGG + Intronic
962780862 3:138715109-138715131 TCTTTCCTACACATAGAGAAGGG - Intronic
963756942 3:149244409-149244431 TCTTTGCGGCATACAGAGAGAGG + Intergenic
967934713 3:194717674-194717696 TCTTAAGCATACACAGAGAATGG - Intergenic
968239643 3:197065640-197065662 TTTTTCCCACACACAGTGACAGG + Intronic
971100643 4:23463204-23463226 TCTTCACCACACACACACAAAGG - Intergenic
971190731 4:24426859-24426881 TCTAAAACATACACAGAGAGCGG + Intergenic
971225593 4:24748747-24748769 TCTTTGCCACACCCAGTGTGTGG + Intergenic
971342491 4:25783304-25783326 TCTTGACAACACACAGATGGAGG + Intronic
974323585 4:60385899-60385921 TCTCTACCAGACATAGAGACGGG + Intergenic
976209668 4:82654804-82654826 TTTTTATCACAGACAGTGAGAGG - Intronic
976483484 4:85572224-85572246 TTTTTACCAAACTCAGAGAAAGG + Intronic
979644832 4:123055704-123055726 TCGTGCGCACACACAGAGAGAGG + Intronic
979929695 4:126616150-126616172 ATATTACCACACACATAGAGTGG - Intergenic
981104626 4:140866433-140866455 CTTTTCCCACACATAGAGAGTGG + Exonic
983585368 4:169348532-169348554 TCCTTTCCACACACAGCCAGTGG - Intergenic
984449531 4:179881836-179881858 GCATTTCGACACACAGAGAGAGG + Intergenic
985176021 4:187202019-187202041 TCTTGCCCACACTCAGTGAGAGG + Intergenic
987386015 5:17330431-17330453 TCTTTACCACACACTTAAATGGG + Intergenic
989350060 5:40475920-40475942 TCTGGACCACACACAGGAAGAGG + Intergenic
990055199 5:51567229-51567251 TTTCTATCACTCACAGAGAGAGG + Intergenic
992174122 5:74133108-74133130 TCTGCAACACACACAGAGAAGGG - Intergenic
992684014 5:79181682-79181704 CCTTTATTACACTCAGAGAGAGG - Intronic
995450486 5:112294583-112294605 TCATTACCATCCACAGAGTGTGG - Intronic
996208172 5:120769341-120769363 TCCTTACCACAAAAAGAGGGAGG - Intergenic
997307920 5:132853468-132853490 TCTTAACCACACACAGCGCCTGG + Intergenic
997648614 5:135498388-135498410 CCTTTGCCTCACACACAGAGTGG - Intergenic
998104433 5:139459409-139459431 TATTGACCAAACCCAGAGAGGGG + Intronic
999481295 5:151950497-151950519 TCTTTTCCTCACACAGAAAACGG + Intergenic
999715393 5:154356174-154356196 TCTCTAGCACACAAAGGGAGAGG - Intronic
1001236150 5:170031315-170031337 TCATTAGCACTGACAGAGAGGGG + Intronic
1001309200 5:170598651-170598673 GCTTAAACTCACACAGAGAGGGG + Intronic
1002283726 5:178148612-178148634 TGTCTACCACACACAGGGACTGG + Exonic
1003341171 6:5222171-5222193 TCTGTACCAGACACATACAGTGG - Intronic
1003905025 6:10691531-10691553 TCTTTACCAGGCCCAGAGTGTGG + Intronic
1004531670 6:16460255-16460277 TTTATACCTCACAGAGAGAGCGG + Intronic
1004842083 6:19598918-19598940 TCTTGATAACACACAGAGAATGG - Intergenic
1009324020 6:62327980-62328002 TCATTAACAGAGACAGAGAGAGG - Intergenic
1011032350 6:82937513-82937535 TCTTTCCCACACACTGAGCATGG - Intronic
1011823517 6:91280128-91280150 TCTTTGCCATACAAGGAGAGCGG - Intergenic
1012621269 6:101347230-101347252 TCCTCACCACACACACAGCGTGG - Intergenic
1015484098 6:133748762-133748784 TCTCAGTCACACACAGAGAGTGG - Intergenic
1016624318 6:146147763-146147785 AATTTACAACAAACAGAGAGGGG + Intronic
1017221302 6:151968900-151968922 TCTTTACCACAGACGGAAAGAGG - Intronic
1017679703 6:156851173-156851195 GCTCTGGCACACACAGAGAGAGG - Intronic
1020692061 7:11368207-11368229 TCTCTCCCACACAATGAGAGAGG - Intergenic
1022834705 7:34102549-34102571 TCCTAACCACATACATAGAGTGG + Intronic
1022973158 7:35535680-35535702 TCTTTACCCCACAGGGAGATTGG + Intergenic
1024661713 7:51501627-51501649 TATTAACCAAACACAGAGAAAGG - Intergenic
1026535949 7:71238661-71238683 GTTTAACCGCACACAGAGAGAGG - Intronic
1027748099 7:82103923-82103945 ACTTTATTACACACAGAGGGAGG + Intronic
1027887029 7:83921628-83921650 TCTTTTCCACACTCACTGAGTGG - Intergenic
1028900249 7:96091033-96091055 CCTTTACCACACACACAGATGGG - Intronic
1029344505 7:99968589-99968611 TATATACAACAGACAGAGAGGGG + Intronic
1029505968 7:100964456-100964478 TCTATAAAACACACAGAGAGAGG + Intronic
1031887567 7:127257166-127257188 TCCTTGCAACACACATAGAGAGG - Intergenic
1033926066 7:146461684-146461706 TCTTTACCACATACAGTGTACGG - Intronic
1034846553 7:154451509-154451531 TCTTCTCCACGCACAGGGAGTGG + Intronic
1035945011 8:3953457-3953479 CCATAAACACACACAGAGAGAGG + Intronic
1041199217 8:55434706-55434728 TCTTTACCACACTGAGTGGGTGG - Intronic
1042835371 8:73075045-73075067 TCTCTACCACAAACAGAAAATGG - Intronic
1045908889 8:107381924-107381946 TCTTGACCACTCACATATAGAGG - Intronic
1047520765 8:125593877-125593899 TCCTTCCCAAACACTGAGAGTGG - Intergenic
1051691641 9:19719419-19719441 TCTTTACAACACTCTCAGAGAGG + Intronic
1052597749 9:30582300-30582322 ATTTTTCCACACACAGAGGGTGG + Intergenic
1053223569 9:36331982-36332004 TGTTCAACACACACAAAGAGAGG - Intergenic
1053290066 9:36873915-36873937 GCTTAACCAGACCCAGAGAGTGG + Intronic
1053436009 9:38075170-38075192 TCATTACCACACACACAAAAAGG - Intergenic
1055476725 9:76669948-76669970 TCTTTATCCCAAAGAGAGAGAGG - Intronic
1056379288 9:86042486-86042508 AATGTACCACACACAGAGAAGGG + Intronic
1056824063 9:89864603-89864625 TCAGGACCACACACACAGAGGGG + Intergenic
1056975628 9:91250458-91250480 CCTTTTCCACACACGGAGACAGG + Intronic
1057417836 9:94880987-94881009 TCTTTACCACAGTCAGTCAGAGG + Intronic
1058994012 9:110281937-110281959 TCTTCACCAAATAGAGAGAGTGG + Intergenic
1059933494 9:119284400-119284422 TCTTTGCCAAACACAGAGCTAGG - Intronic
1060104456 9:120865152-120865174 TCTCCACCACATACAGAGTGAGG - Intronic
1060321986 9:122571177-122571199 TCTGTACCACACAGAAAGATTGG - Intergenic
1060746681 9:126139505-126139527 TCTCATACACACACAGAGAGAGG - Intergenic
1061373959 9:130213231-130213253 TCTTCTCCATACACAGAGGGTGG + Intronic
1062051501 9:134449635-134449657 TCTTTAGTATACACAGAGCGAGG + Intergenic
1062171157 9:135135608-135135630 TCTTTGCCACACATATGGAGAGG + Intergenic
1062436850 9:136550187-136550209 TCTGCCTCACACACAGAGAGTGG - Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1200079583 X:153569399-153569421 TCTGTGCCACCCACCGAGAGAGG - Intronic