ID: 923228005

View in Genome Browser
Species Human (GRCh38)
Location 1:231957130-231957152
Sequence ACAACCCAGGTCCAATCAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923228005_923228009 15 Left 923228005 1:231957130-231957152 CCGCTTGATTGGACCTGGGTTGT 0: 1
1: 0
2: 1
3: 8
4: 90
Right 923228009 1:231957168-231957190 TTTTCTCCCTATGGAACATTTGG 0: 1
1: 0
2: 5
3: 54
4: 380
923228005_923228007 6 Left 923228005 1:231957130-231957152 CCGCTTGATTGGACCTGGGTTGT 0: 1
1: 0
2: 1
3: 8
4: 90
Right 923228007 1:231957159-231957181 GCCTTCATCTTTTCTCCCTATGG 0: 1
1: 0
2: 4
3: 27
4: 248
923228005_923228011 21 Left 923228005 1:231957130-231957152 CCGCTTGATTGGACCTGGGTTGT 0: 1
1: 0
2: 1
3: 8
4: 90
Right 923228011 1:231957174-231957196 CCCTATGGAACATTTGGCTCCGG 0: 1
1: 0
2: 1
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923228005 Original CRISPR ACAACCCAGGTCCAATCAAG CGG (reversed) Intronic
905656795 1:39690916-39690938 ACAACCCATATCCAAACAGGAGG + Intronic
906511276 1:46411664-46411686 ACCACCCTGCTCCAATCCAGAGG - Intronic
911785538 1:101941770-101941792 ACAGCCTAGGTTCAAACAAGTGG + Intronic
916497736 1:165360348-165360370 ACAGGCCAGGACCAATCAATGGG + Intergenic
916588623 1:166168729-166168751 AAAACCCTGGTCTAATCATGAGG - Intergenic
918429801 1:184447895-184447917 CCAACCCTGGTCCACTTAAGTGG + Intronic
918527460 1:185480483-185480505 CCAACCCAGCTCCAATCCATGGG - Intergenic
921267884 1:213440650-213440672 ACAAACCAAGTTCAAGCAAGAGG + Intergenic
923162162 1:231323937-231323959 ACAACTCAGGAACAATCAAGTGG + Intergenic
923228005 1:231957130-231957152 ACAACCCAGGTCCAATCAAGCGG - Intronic
1068151298 10:53135756-53135778 ACAACACAGAGCCAATCAAGAGG + Intergenic
1068372242 10:56131929-56131951 ACACACCAGGGCCAATCAGGGGG + Intergenic
1071239801 10:83692968-83692990 ACAACCCATGTCCATTTTAGGGG + Intergenic
1072543582 10:96416991-96417013 ACAGCCTGGGTCCAACCAAGGGG + Intronic
1086438301 11:86802753-86802775 ACAACACAGGTCTCCTCAAGAGG - Intronic
1088625358 11:111726482-111726504 ACAACACAGGTCCCAGCAGGAGG - Exonic
1088743907 11:112788442-112788464 ACAATCCAGGCACAAACAAGGGG + Intergenic
1089606635 11:119645199-119645221 ACCACCCAGGGCCCATCCAGTGG + Intronic
1089672270 11:120064699-120064721 ACAACTCAGGTGCAACCAAATGG + Intergenic
1097516110 12:60608384-60608406 ACAGCCCAGGTGGAATCAACTGG - Intergenic
1097773103 12:63612940-63612962 ACAACCAAAGTTCACTCAAGAGG + Intronic
1100794299 12:98164232-98164254 ACAACCCAGGAACGATCAAATGG + Intergenic
1102828336 12:115970471-115970493 ACAACCCAGGAACTATAAAGAGG - Intronic
1103616403 12:122155665-122155687 GCAGCCCAGGTCCCAGCAAGAGG + Intergenic
1104847554 12:131854258-131854280 AGAACCGAGGTCCCATCACGAGG - Intergenic
1107458762 13:40580196-40580218 ACAAAGCAGTTCCTATCAAGTGG + Intronic
1113010202 13:105756041-105756063 ACAACTCAGGTCTAGACAAGTGG + Intergenic
1117269162 14:54123894-54123916 ATAACCCAATTCCAATCAACAGG + Intergenic
1118932181 14:70253106-70253128 ACAACCCAATTCCAATCATATGG - Intergenic
1119309389 14:73633825-73633847 CCAGCCCAGGTCCCATCACGTGG + Intergenic
1119968087 14:78939212-78939234 ACACTCCAGGTACATTCAAGTGG + Intronic
1121582014 14:95038746-95038768 ACAAGCCAGGTGCCAGCAAGTGG + Intergenic
1125396218 15:39251005-39251027 ACAATCCAGGCCAACTCAAGTGG - Intronic
1127386155 15:58468844-58468866 ACAACCCAGGTCCAGTAAATTGG + Intronic
1128920914 15:71609446-71609468 ACAGCCCAAGTTAAATCAAGAGG - Intronic
1131370869 15:91880760-91880782 ACAACCCAAATGCCATCAAGAGG - Intronic
1135068598 16:19332750-19332772 ACTCCCCTGGTCCAATCAAATGG + Intergenic
1138148277 16:54631641-54631663 TCAACCGAGGTCCCATCATGAGG + Intergenic
1143004890 17:3823914-3823936 ACAACCCAAATTCAATCAGGAGG + Intronic
1143196002 17:5076958-5076980 TCAACCATGGACCAATCAAGGGG - Intergenic
1145082249 17:19903566-19903588 TCAACCCAGGTCCAATCAACTGG + Intergenic
1146390257 17:32415631-32415653 ATAACCCAGTCCCAATCAATGGG + Intergenic
1146482956 17:33219765-33219787 ACAACCCAGGGCCCTTCAAAAGG - Intronic
1149691258 17:58578685-58578707 ACAAGGCAGGTCCAAAAAAGAGG + Intronic
1150536076 17:66042443-66042465 ACAACCCCAGTCTAATCATGAGG + Intronic
1164400767 19:27900667-27900689 CCAACCCAGGTCTAAGCATGGGG - Intergenic
1165422561 19:35729522-35729544 GCAGCCCAGGTTCAATCAATGGG - Intronic
1167140493 19:47647452-47647474 ACAACCCAGATCCTATCAACAGG - Intronic
1167755344 19:51409664-51409686 ACACCCCAGCTCCAGTCCAGAGG - Intergenic
1167765009 19:51476337-51476359 TCAACCCATATCCAATCCAGTGG + Intergenic
925140625 2:1547459-1547481 ACAACCCAGGCCCATTCCAAAGG - Intergenic
928674996 2:33641980-33642002 ACAACTCAGGACCAATCAGATGG + Intergenic
928896079 2:36265131-36265153 ACAACCCAGTACCCATCAAAAGG + Intergenic
933809197 2:86021886-86021908 ATAAACCAGGTCCTATCAGGGGG + Exonic
935369785 2:102333136-102333158 AGAACCTAGGTCAAATCAAGGGG - Intronic
935848855 2:107197334-107197356 ACATCCCAGGTTCACTCATGAGG - Intergenic
940852122 2:158698220-158698242 ACACACCAGGGCCAGTCAAGGGG + Intergenic
943229605 2:185231604-185231626 ACAAACCAGGTCTTACCAAGAGG + Intergenic
943415428 2:187596721-187596743 ATAACTCAAGTCTAATCAAGAGG + Intergenic
946368871 2:219268048-219268070 AAATCCCAGGTCCAATCCTGGGG - Intronic
946612676 2:221476261-221476283 ACAACTCAGGTCCACTCCAGAGG + Intronic
947830161 2:233134040-233134062 TCACCCCACATCCAATCAAGCGG - Intronic
948177093 2:235952675-235952697 ACTACCCAGGGCCACTCAGGGGG - Intronic
1168932961 20:1638779-1638801 ACACACCAGGGCCAGTCAAGGGG - Intronic
1175110010 20:56641285-56641307 AAAAACCAGGTCCCCTCAAGAGG + Intergenic
1177961843 21:27676724-27676746 ACAAACCAGGTGAAATTAAGCGG - Intergenic
1183356948 22:37364704-37364726 ACAATCCAGGCCAAATCCAGGGG + Intergenic
951682004 3:25304667-25304689 ATAACCCAGGTGAAATCAAATGG - Intronic
955126127 3:56114601-56114623 ACAACCCAGGAACAAACAAATGG + Intronic
955730847 3:61984931-61984953 ACAACCCTGGTATAATCATGGGG - Intronic
959175278 3:102901448-102901470 ACAAATGAGGTCCAATCAAATGG + Intergenic
960640508 3:119818161-119818183 CAAACCCAGGCCCCATCAAGTGG - Exonic
962417667 3:135198196-135198218 ACAACCCATCTCCGATCAACTGG - Intronic
970062634 4:12051806-12051828 ACACACCAGGGCCAATCAGGGGG + Intergenic
971325734 4:25642267-25642289 ACAACTCCTGTCCCATCAAGTGG - Intergenic
971866194 4:32175802-32175824 ACACCCCAGGGCTAAGCAAGAGG + Intergenic
985659647 5:1150550-1150572 AAAACCCAGGTCCCCTCCAGTGG + Intergenic
990223755 5:53626045-53626067 ACAACCCAGGGCCCATCAGAGGG - Intronic
990334879 5:54762775-54762797 ACAACAAAGGTCCATTGAAGTGG - Intergenic
999186918 5:149718078-149718100 ACAACAGATGTCCAATCAAAAGG - Intergenic
1001302756 5:170548733-170548755 AAAACCCAGGCCCTACCAAGTGG - Intronic
1008509168 6:52260282-52260304 CCAACCCAGGTTTTATCAAGTGG + Intergenic
1010004415 6:70980121-70980143 ACACACCAGGTCCTGTCAAGGGG + Intergenic
1014291073 6:119559535-119559557 AAAACCCACGTCCAATTAAGGGG - Intergenic
1022365039 7:29704954-29704976 ACAACCAAAGTTCACTCAAGAGG - Intergenic
1022932667 7:35136644-35136666 ACAACCAAAGTTCACTCAAGAGG + Intergenic
1023517213 7:41013405-41013427 CCAGCCCAGGTCCAAAGAAGGGG + Intergenic
1024127293 7:46312500-46312522 ACTACACAGGTCCAATGACGTGG - Intergenic
1028960639 7:96746050-96746072 GCAACCTAGATCCAATCAATAGG + Intergenic
1031040201 7:116831241-116831263 ACAACCCCAGTCTAATCATGGGG + Intronic
1035093713 7:156334844-156334866 ACAACCCAGGTCCAGACATCAGG + Intergenic
1036632264 8:10524120-10524142 ACCACCCAGGGCCACTCAACAGG + Intergenic
1037894352 8:22641899-22641921 ACTCCCCAGGTCCCATAAAGTGG - Intronic
1040519372 8:48161837-48161859 ACAACACAGGCCCTGTCAAGGGG - Intergenic
1059125560 9:111681334-111681356 ATAACCCAAGTCTAATCACGAGG + Intergenic
1059622925 9:116028424-116028446 ACAACTCAGGTCATAGCAAGAGG - Intergenic
1186623101 X:11262547-11262569 ACTCCCCAGGGCCAAACAAGGGG + Intronic
1192720879 X:73696610-73696632 ACACACCAGGTCCTATCAAGGGG + Intergenic
1194591221 X:95802294-95802316 ACAAACCATGCCCATTCAAGAGG + Intergenic
1198562972 X:137871303-137871325 AAACCCCAGATCAAATCAAGAGG - Intergenic