ID: 923231051

View in Genome Browser
Species Human (GRCh38)
Location 1:231986765-231986787
Sequence TAATGTGACCACAGTGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923231045_923231051 23 Left 923231045 1:231986719-231986741 CCCACAGCAAGGAGCCTGTCACT No data
Right 923231051 1:231986765-231986787 TAATGTGACCACAGTGCAGTGGG 0: 1
1: 0
2: 0
3: 15
4: 130
923231046_923231051 22 Left 923231046 1:231986720-231986742 CCACAGCAAGGAGCCTGTCACTT 0: 1
1: 0
2: 0
3: 26
4: 221
Right 923231051 1:231986765-231986787 TAATGTGACCACAGTGCAGTGGG 0: 1
1: 0
2: 0
3: 15
4: 130
923231044_923231051 24 Left 923231044 1:231986718-231986740 CCCCACAGCAAGGAGCCTGTCAC 0: 1
1: 0
2: 0
3: 26
4: 208
Right 923231051 1:231986765-231986787 TAATGTGACCACAGTGCAGTGGG 0: 1
1: 0
2: 0
3: 15
4: 130
923231048_923231051 9 Left 923231048 1:231986733-231986755 CCTGTCACTTCACTTGGTGTATC No data
Right 923231051 1:231986765-231986787 TAATGTGACCACAGTGCAGTGGG 0: 1
1: 0
2: 0
3: 15
4: 130
923231043_923231051 25 Left 923231043 1:231986717-231986739 CCCCCACAGCAAGGAGCCTGTCA 0: 1
1: 1
2: 3
3: 17
4: 188
Right 923231051 1:231986765-231986787 TAATGTGACCACAGTGCAGTGGG 0: 1
1: 0
2: 0
3: 15
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923231051 Original CRISPR TAATGTGACCACAGTGCAGT GGG Intronic
903789101 1:25880673-25880695 TGATGGGAGCACGGTGCAGTAGG + Intergenic
903789104 1:25880721-25880743 CAGTGTGAGCACGGTGCAGTGGG + Intergenic
908180933 1:61604816-61604838 TATGGTGACTACAGTACAGTGGG + Intergenic
909865226 1:80660260-80660282 TAAGGTGACCATTGTGCATTAGG + Intergenic
911553619 1:99315481-99315503 TAATGTGTCCAGATGGCAGTAGG + Intergenic
911623159 1:100090617-100090639 TAATGAGGCCACAGTGCCTTTGG - Intronic
916466223 1:165076924-165076946 TAAGGTGATAACAGTGCAGATGG + Intergenic
917929101 1:179811717-179811739 CTTTGTGAGCACAGTGCAGTTGG + Intronic
918073593 1:181152344-181152366 TAATGTGACCTCTATGAAGTAGG + Intergenic
918985561 1:191621082-191621104 GAATGTGAGCACACAGCAGTTGG - Intergenic
919720156 1:200825105-200825127 TAATATAACCACAGTGAAGGCGG - Intronic
923231051 1:231986765-231986787 TAATGTGACCACAGTGCAGTGGG + Intronic
1064793455 10:18985479-18985501 TAAGCTGTCCACAGTGCTGTGGG + Intergenic
1065554919 10:26905734-26905756 GAATTTGAGCACAGTGCCGTCGG - Intergenic
1065755658 10:28928010-28928032 TAAAGTGACCACAGTTCCCTTGG - Intergenic
1069531871 10:69225663-69225685 TAATGTGAGCCCTGTGCATTTGG + Intronic
1071093553 10:81947763-81947785 TAATATGACAAAAGTGCCGTCGG + Intronic
1071369471 10:84936522-84936544 TAATGTGACCAATGGGCTGTGGG - Intergenic
1072554191 10:96502272-96502294 TAATGTCACCCCATTGCACTTGG - Intronic
1074583480 10:114744084-114744106 TGATGGGACCACAGTTCTGTTGG + Intergenic
1075065955 10:119288927-119288949 GAATGTGACCTGAGTGCTGTTGG - Intronic
1075240051 10:120770224-120770246 AAATGTGAGCAAAGTGCAGAGGG + Intergenic
1075787212 10:125058153-125058175 GAACTTGACCACTGTGCAGTAGG + Intronic
1076354887 10:129844444-129844466 TAATGCAAATACAGTGCAGTCGG + Intronic
1078291465 11:10014636-10014658 TAATGTAACCACACTGAAGAGGG - Intronic
1078412130 11:11133068-11133090 TAATGTAACCACATTGTAGGCGG + Intergenic
1079484755 11:20923621-20923643 GAATGGGATTACAGTGCAGTTGG - Intronic
1080609283 11:33890088-33890110 TAATGTGAACACATGGCATTAGG + Intronic
1081177905 11:39951466-39951488 TAATCTGCTCACAGTGCTGTGGG - Intergenic
1081962804 11:47150767-47150789 TAGTGTGGCCAGAATGCAGTGGG + Intronic
1082616613 11:55368692-55368714 TAAAATGACCACAGTGACGTGGG - Exonic
1082626394 11:55491922-55491944 TAAAGTGATCACAGTGATGTGGG - Intergenic
1082962395 11:58931306-58931328 AAATGTGATCACACTGCAGTAGG - Intronic
1084142998 11:67246219-67246241 TTATGTGACCACAGAGCTGATGG - Intronic
1085231501 11:74975153-74975175 TAATGTGAACAGAATGAAGTGGG - Intronic
1085795056 11:79531713-79531735 TCAGGAGACCACAGTGCAGAGGG - Intergenic
1090469038 11:126962760-126962782 AAATAAGACCACAGTGAAGTTGG - Intronic
1093532905 12:20188280-20188302 TAATGAGACTTCAGAGCAGTAGG - Intergenic
1093919005 12:24838131-24838153 TGATGTAACCCCAGTGGAGTGGG - Intronic
1095225646 12:39673897-39673919 TAATGTGTCCACTATGTAGTAGG - Intronic
1103070303 12:117935799-117935821 TTGTGTGACCAGAGTGGAGTGGG - Intronic
1104218424 12:126757891-126757913 GAATGTGTGCTCAGTGCAGTTGG + Intergenic
1106190580 13:27449347-27449369 TGTAGTGACCGCAGTGCAGTGGG - Intronic
1110265895 13:73537265-73537287 TAAAGTGACTACAGAGCAGGAGG - Intergenic
1110591477 13:77267461-77267483 TACTTTAACAACAGTGCAGTTGG - Intronic
1110735457 13:78930508-78930530 TAAAGTGTCCAGAGTCCAGTTGG - Intergenic
1112678908 13:101739668-101739690 GAATGTGAACACACAGCAGTAGG + Intronic
1113259791 13:108549007-108549029 CAATCTGAACACAGTGCTGTGGG - Intergenic
1113338138 13:109396426-109396448 TGCTGTGACCACAGGGCAGGAGG + Intergenic
1115438298 14:33402349-33402371 TAATGTGACCACTGAGAAATGGG + Intronic
1127596779 15:60491743-60491765 CAATGTCTCCACAGTGCAATTGG - Intronic
1128235850 15:66066614-66066636 TGGTGTGACCACAGTGCAGCAGG - Intronic
1141913273 16:87075596-87075618 TAATGTGACCCCAGTCCACATGG + Intergenic
1150491560 17:65577746-65577768 TGATGTAAACACAGTGCAGTGGG + Intronic
1155167437 18:23242671-23242693 TGATGTGAACACAGTGCAAGAGG - Intronic
1156386835 18:36612846-36612868 TGATGTAAAAACAGTGCAGTCGG - Intronic
925962027 2:9026777-9026799 TCATCTGACCAAATTGCAGTGGG + Intergenic
928651364 2:33406697-33406719 TAATGTGATCACAGTTAACTAGG - Intergenic
928854263 2:35785263-35785285 TAATGTGGCTACAGTACAGGTGG - Intergenic
935581377 2:104758593-104758615 TGATCTGACCACAGTGCAGGTGG - Intergenic
936076004 2:109402294-109402316 TGCTGTGACCACAGTGCTGCAGG + Intronic
936667211 2:114610370-114610392 TAATGTGACCATATTTCACTGGG + Intronic
936746510 2:115582865-115582887 TTTTGTCACCACATTGCAGTGGG + Intronic
937247073 2:120500403-120500425 TAAGGGGCCCACAGTGCAGTGGG + Intergenic
940895138 2:159074193-159074215 TCTGGTGACCACAGTGCAGTGGG + Intronic
941026356 2:160460497-160460519 TGATATGACCACAGGTCAGTGGG + Intronic
941567227 2:167124593-167124615 TAATGAGCTGACAGTGCAGTGGG + Intronic
942015724 2:171812666-171812688 TAGACTGAGCACAGTGCAGTTGG - Intronic
942492011 2:176498844-176498866 TAATGTGAATACAGTCCAGAGGG + Intergenic
945696227 2:213108366-213108388 TATTATGACCACAGTTCATTGGG - Intronic
946991331 2:225333329-225333351 TAGTGTGACTACAGTGTAATAGG - Intergenic
947993693 2:234508893-234508915 TCAGGAGACCACAGTGCATTAGG - Intergenic
948105351 2:235409150-235409172 CCATGAGACCACAGAGCAGTTGG - Intergenic
1169036155 20:2454057-2454079 TATTGTGCGCACAGAGCAGTGGG + Intergenic
1172216388 20:33238602-33238624 CAAAATGACCACAGTGTAGTGGG - Intronic
1173839195 20:46146122-46146144 TGATGTGGCCACAGTGCTGATGG - Intergenic
1177107355 21:16976340-16976362 TTAAGTCACCACAGTGCAGGGGG + Intergenic
1178055998 21:28799030-28799052 TGTTGTGTGCACAGTGCAGTTGG - Intergenic
1178491261 21:33053558-33053580 TGATGGGTCCACAGAGCAGTAGG + Intergenic
1178510685 21:33202565-33202587 TTTTGTGACCACAATGCAGAAGG - Intergenic
1182314259 22:29433420-29433442 TATAGTGACCACAGAGCAGATGG - Intergenic
1183280598 22:36929959-36929981 TACTGTGACCACTGACCAGTAGG + Intronic
949432159 3:3989399-3989421 CAATGTGAGCACAGTGCTATGGG + Intronic
951220932 3:20068325-20068347 CAATGTGGCTACAGCGCAGTGGG - Intronic
952421350 3:33134199-33134221 TAATGTGACCACACTCCAGAAGG + Exonic
953906974 3:46873293-46873315 GAATGGGAACACAGGGCAGTGGG + Intronic
958685268 3:97385682-97385704 TAATATGCCCACAGTTCTGTGGG + Intronic
961782747 3:129330520-129330542 TAATGTGACCTCAATGGAGTAGG - Intergenic
963532918 3:146493976-146493998 TACTGTGACTACAGAGCTGTTGG + Intronic
969141484 4:5077992-5078014 TAATCAGACAACAGTGCAGCAGG - Intronic
971174216 4:24265328-24265350 TTCTGGGACCACAGTGCATTTGG + Intergenic
972207689 4:36797995-36798017 CCATGTGGCCACAGTGCGGTTGG - Intergenic
976493755 4:85701903-85701925 TGATCTGACCACATTGCAGATGG - Intronic
977864492 4:102008085-102008107 TCATCTGCCCACAGTGCAGATGG + Intronic
981085474 4:140678705-140678727 TCCTGTGAACACAGTGCTGTGGG - Intronic
982081709 4:151796700-151796722 TAATGTGGCCAAAGTCAAGTGGG + Intergenic
982351237 4:154417301-154417323 AAATGTGCTCACAGTGCACTTGG - Intronic
982767235 4:159362992-159363014 CCATTTGACCACAGTGCATTTGG - Intergenic
986899941 5:12418877-12418899 TAATGTGACCACACATCAGAAGG - Intergenic
993536376 5:89091886-89091908 TAATGTGTCTACAGGTCAGTTGG + Intergenic
996528761 5:124504826-124504848 GCATGTGACCTCAGGGCAGTGGG - Intergenic
998504161 5:142658571-142658593 TTATGGGACCACATTGTAGTGGG + Intronic
998651236 5:144123997-144124019 AAATGCCACCACAGTGCAGCAGG + Intergenic
999247592 5:150163513-150163535 TAAGGGGACCACAGAGCAGCTGG + Intergenic
999833294 5:155341453-155341475 TCATGAGCCCACAGTGCAGCAGG + Intergenic
1001056529 5:168454559-168454581 TAATGTGACCCTAGTGCAGCAGG - Intronic
1004286225 6:14323079-14323101 CAATGTGAACACAGAGCAGTGGG + Intergenic
1005193079 6:23250120-23250142 TCTTGTGACCACTGTGTAGTGGG + Intergenic
1006660710 6:35641407-35641429 AACTGTGACTGCAGTGCAGTAGG + Intronic
1007285702 6:40745960-40745982 GAAAGTGATCACAGTCCAGTGGG + Intergenic
1008125402 6:47662739-47662761 TATTTTGCCAACAGTGCAGTGGG - Intronic
1008893168 6:56519620-56519642 TACTGGTACCACAGTGCAGGTGG - Intronic
1010972178 6:82274657-82274679 TAATGTGCCCACAGTTCACGTGG - Intergenic
1011778004 6:90753581-90753603 TAATGTGTACACAGCGTAGTGGG + Intergenic
1012273625 6:97244860-97244882 TGATGCGACCACTGTGGAGTGGG + Intronic
1014318946 6:119901814-119901836 GAATATGACAAAAGTGCAGTTGG + Intergenic
1016908623 6:149175714-149175736 AAATGTGACAACAGAGCAGGAGG - Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017553645 6:155539581-155539603 GAGTTTGACCACAGTGCAGTGGG + Intergenic
1021402880 7:20229880-20229902 TAATGGGACCGCTGTTCAGTTGG - Intergenic
1025639272 7:63352041-63352063 CCATCTGACCACAATGCAGTTGG + Intergenic
1025643427 7:63396051-63396073 CCATCTGACCACAATGCAGTTGG - Intergenic
1026562400 7:71461392-71461414 TAATGAGAACAAAGTACAGTAGG - Intronic
1030448444 7:109677359-109677381 TAATGTAACCATAGTGAAATGGG - Intergenic
1030855310 7:114548589-114548611 TAATGTGACTAAAGTTCAGTGGG + Intronic
1039997828 8:42549599-42549621 TAATGGGTCCAGAGTTCAGTTGG + Intronic
1041182826 8:55266244-55266266 TGATGTGAGCGCAGTACAGTGGG + Intronic
1043566378 8:81553055-81553077 TAATGTGACCATGGTGGAGATGG + Intergenic
1045653754 8:104366494-104366516 TATTGTGATCACACTGTAGTTGG + Intronic
1049304183 8:141890832-141890854 AAATGTGACCCCAGTGCTGGAGG - Intergenic
1050211530 9:3263937-3263959 TAATGTTACCACAGTCCTGAGGG + Intronic
1050870993 9:10569748-10569770 TCATGTGACCACAATTCAATAGG + Intronic
1055499230 9:76886620-76886642 TTAGGTGAACACAGTGCATTTGG - Intronic
1056440620 9:86617581-86617603 TCATGTGACCACAGAGCTGGTGG - Intergenic
1059600390 9:115770964-115770986 TAATGTGACCAAAGCAGAGTAGG + Intergenic
1186262170 X:7791282-7791304 GAATTGGACCACAGTGCAGTGGG - Intergenic
1186939349 X:14488209-14488231 TATTGTGAGCACAGTGCCTTTGG + Intergenic
1188392892 X:29642879-29642901 TAAGGTAACCACAGTGCAGCTGG + Intronic
1191674839 X:63783854-63783876 TAATGGGACCTCAGGGAAGTAGG + Intronic
1192349548 X:70345885-70345907 CAATGTAAGCAAAGTGCAGTGGG + Intronic
1193139355 X:78010193-78010215 GAATATGACCACATTGCTGTGGG - Intronic
1197291375 X:124662522-124662544 TAATTTGACAAAAGGGCAGTTGG - Intronic
1198323979 X:135548703-135548725 TAATGGGTCCACTGTGCAGTAGG - Intronic
1200713779 Y:6514186-6514208 AAATGTGGCCACATTGAAGTGGG - Intergenic
1201020047 Y:9646973-9646995 AAATGTGGCCACATTGAAGTGGG + Intergenic
1201693627 Y:16798693-16798715 TAATCTTACCAAAGTGCATTTGG - Intergenic