ID: 923234620

View in Genome Browser
Species Human (GRCh38)
Location 1:232020514-232020536
Sequence TACAAAGATCTGCCTCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923234620_923234622 -3 Left 923234620 1:232020514-232020536 CCTGAAGGAGGCAGATCTTTGTA 0: 1
1: 0
2: 2
3: 12
4: 153
Right 923234622 1:232020534-232020556 GTAAATGCATTTGCTGTCCTGGG No data
923234620_923234625 21 Left 923234620 1:232020514-232020536 CCTGAAGGAGGCAGATCTTTGTA 0: 1
1: 0
2: 2
3: 12
4: 153
Right 923234625 1:232020558-232020580 AACAAGATGGTGTTAAGATAAGG 0: 1
1: 0
2: 1
3: 22
4: 207
923234620_923234623 8 Left 923234620 1:232020514-232020536 CCTGAAGGAGGCAGATCTTTGTA 0: 1
1: 0
2: 2
3: 12
4: 153
Right 923234623 1:232020545-232020567 TGCTGTCCTGGGAAACAAGATGG 0: 1
1: 0
2: 7
3: 22
4: 273
923234620_923234621 -4 Left 923234620 1:232020514-232020536 CCTGAAGGAGGCAGATCTTTGTA 0: 1
1: 0
2: 2
3: 12
4: 153
Right 923234621 1:232020533-232020555 TGTAAATGCATTTGCTGTCCTGG 0: 1
1: 0
2: 3
3: 13
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923234620 Original CRISPR TACAAAGATCTGCCTCCTTC AGG (reversed) Intronic
901264766 1:7902212-7902234 TATACAGACCTGACTCCTTCAGG + Intergenic
901442872 1:9290148-9290170 TACAAAGATCTGTGTACTGCAGG - Intergenic
904029590 1:27525922-27525944 GACAGAGCTCTGTCTCCTTCAGG + Intergenic
905177241 1:36145004-36145026 AAAAAAGATCAGCCTCCTTAAGG - Intronic
905380579 1:37558922-37558944 TACACACATCTGCCTCTTTCTGG + Intronic
905987843 1:42303476-42303498 GAAATAAATCTGCCTCCTTCTGG + Intronic
911306146 1:96234787-96234809 TACAAAGATTTTCCTCCCTTAGG - Intergenic
913070778 1:115296478-115296500 TAGGAAGATCTGCATTCTTCGGG + Intronic
914899604 1:151704775-151704797 TACAAAGACTTGGCTCTTTCTGG + Intronic
915229424 1:154434601-154434623 TAGAAAGAGCTGTCTCCCTCCGG - Exonic
916823408 1:168422401-168422423 TGCAAAGCTCTGCCTCCTGCTGG + Intergenic
918419859 1:184353145-184353167 AAAAAAGCTCTGCTTCCTTCGGG + Intergenic
920870802 1:209792902-209792924 TAGAAGGATCTGACTCCTCCAGG + Intronic
923234620 1:232020514-232020536 TACAAAGATCTGCCTCCTTCAGG - Intronic
1063942426 10:11143921-11143943 TTTAAAGAGCTGTCTCCTTCAGG - Intronic
1069829158 10:71272016-71272038 CACAAAGCTCTTCCTCCATCTGG - Intronic
1070123564 10:73601682-73601704 TACAAAGATCTGCTTGCTGGAGG - Intronic
1072508837 10:96097728-96097750 TAGAGAAATCTGCCTCCTTTAGG - Intergenic
1073062930 10:100742999-100743021 TCCAAAGCTCTGCCTTCTCCTGG - Intronic
1073080402 10:100856387-100856409 TAAAAGCATCTGCCTCATTCTGG - Intergenic
1073463814 10:103682148-103682170 TCCAACTAGCTGCCTCCTTCTGG + Intronic
1073795931 10:106988467-106988489 TGAAAAAATCTGCCTCCTTCTGG + Intronic
1074223177 10:111458612-111458634 TACAAAGACCAACCTCCTCCAGG - Intergenic
1075069099 10:119308945-119308967 TGGGAAGATCTGCCTCCCTCAGG - Intronic
1078905797 11:15686698-15686720 TACAAAGCACTGTCTCCTCCAGG + Intergenic
1081885946 11:46496520-46496542 TCCAAAGATTCACCTCCTTCTGG + Intronic
1083584596 11:63847564-63847586 TACAAAGGTCTGCCTCCTTTGGG + Intronic
1089207432 11:116775657-116775679 AAAAAAGCTCTGCTTCCTTCTGG + Intergenic
1096706373 12:53424834-53424856 TACAGCCATCTGCCTCCTCCAGG + Exonic
1098954073 12:76670417-76670439 TACAAAGAGCAGCCCTCTTCTGG - Intergenic
1100035128 12:90241105-90241127 TAGATAAATCTGCCTCATTCTGG - Intergenic
1100404441 12:94261279-94261301 TCCAAAGAGCTGCCTCCCCCTGG + Intronic
1101663760 12:106790031-106790053 TACAAAGATTTGCTTCTTACCGG + Intronic
1102483376 12:113239423-113239445 TACACAGCTGTGCCTCTTTCTGG + Intronic
1103467932 12:121156809-121156831 TCCAAAGAGCCGCCTCTTTCTGG + Intronic
1103904205 12:124319177-124319199 TCCCTAGACCTGCCTCCTTCAGG + Intergenic
1104036289 12:125099341-125099363 GACAAAGGTCTACCTCCTCCAGG - Intronic
1105294161 13:19073664-19073686 TAAAAAGATTTGCACCCTTCAGG + Intergenic
1105621457 13:22071495-22071517 AACAAAGAGATGCCTCCTTGGGG + Intergenic
1106122018 13:26867925-26867947 TACAAACATTTCCTTCCTTCAGG - Intergenic
1108074645 13:46667108-46667130 AAGAAAAATCTGCCTCTTTCTGG + Intronic
1110040984 13:70758264-70758286 TACATAGATTTTCCTCCATCAGG + Intergenic
1110188041 13:72698192-72698214 GACAAAGATCTTCCTTCTTTGGG - Intergenic
1111619039 13:90699830-90699852 TCTACAGATCTGTCTCCTTCTGG - Intergenic
1112068699 13:95823669-95823691 TCCAAATATCTGCTTTCTTCAGG - Intronic
1112157978 13:96838141-96838163 TGGAAAGATCTGCCTCCTTTAGG - Exonic
1112380032 13:98880157-98880179 AACAAAGAGCTGCATCCTGCCGG + Intronic
1115499561 14:34037185-34037207 TACAAAGAATTCCCTCTTTCTGG - Intronic
1116543739 14:46135611-46135633 TCAATAGATCTGGCTCCTTCTGG - Intergenic
1116932461 14:50703487-50703509 AACAAAGATCAGCCACGTTCGGG - Intergenic
1121535003 14:94685202-94685224 TAGCAAGACCTGCCTCCTCCAGG + Intergenic
1121666358 14:95675432-95675454 TACAAACAATTGCTTCCTTCTGG + Intergenic
1127335646 15:57980541-57980563 TGTGAAGCTCTGCCTCCTTCTGG + Intronic
1128557077 15:68639164-68639186 CACAAGGAGGTGCCTCCTTCAGG - Intronic
1130043743 15:80428180-80428202 TCCACAGTTCTGCCTCTTTCAGG - Intronic
1130920657 15:88341774-88341796 TACTAAGATCTACCTTCTTAAGG + Intergenic
1132286852 15:100669610-100669632 TACAAAAGCCTGCCTCATTCAGG - Intergenic
1135952094 16:26924112-26924134 TCAAGAGATCTGCCCCCTTCAGG - Intergenic
1139109756 16:63875382-63875404 TACACACATCTGACCCCTTCAGG - Intergenic
1141776052 16:86123028-86123050 TCCAAACATCTGCCTTCCTCTGG - Intergenic
1144067374 17:11636765-11636787 TACCAAGTTCTGCTTCCTCCTGG - Exonic
1145003541 17:19322009-19322031 AACAAAAATCTGCCCCCTGCTGG - Intronic
1148875117 17:50682623-50682645 TACTAAAGTCTGCCTCCTCCAGG + Intronic
1158127959 18:54122683-54122705 TAAAAAAATCTTCCTCTTTCTGG + Intergenic
1158654110 18:59313239-59313261 TTCAAAGAACTGCCTGGTTCTGG - Intronic
1159591475 18:70339631-70339653 TAAAACCATCAGCCTCCTTCTGG - Intronic
1160815013 19:1031091-1031113 TGCGGAGCTCTGCCTCCTTCTGG - Exonic
1161266851 19:3368079-3368101 TTCAAAGAGATGCCTTCTTCGGG - Intronic
1162013633 19:7831935-7831957 AACAAAGAGCTGCCTGCTTCTGG - Intronic
1162344715 19:10112477-10112499 GAGAAAAATCTCCCTCCTTCGGG - Intronic
1164496267 19:28765933-28765955 AACAAATATCTGCCTTCTTCAGG + Intergenic
1165188404 19:34041278-34041300 AACAGAGCTCTTCCTCCTTCTGG + Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
926867378 2:17374796-17374818 AACCAAGATCCACCTCCTTCAGG + Intergenic
929653564 2:43706716-43706738 TACAAAGATCTGCCTAAATTAGG - Intronic
930388497 2:50729688-50729710 CACAAAGAACAGCCTCCCTCGGG + Intronic
932573764 2:72951651-72951673 TACAAAGAACTTCCTCCTGCTGG + Intronic
933084856 2:78043413-78043435 CACAAAGATCTCCCTCTTTCTGG + Intergenic
934488167 2:94737420-94737442 TGCGGAGCTCTGCCTCCTTCTGG - Intergenic
936489658 2:112959154-112959176 TAGCAATATCTGCCTCCTTAGGG + Intergenic
936811244 2:116405652-116405674 TACAACAATCTCCCTCATTCTGG - Intergenic
937808655 2:126175048-126175070 AACAAAAATCTGCCTCTTTTAGG - Intergenic
939358363 2:141134238-141134260 TAGTAAGGTCTCCCTCCTTCAGG + Intronic
941726202 2:168863479-168863501 TAGAAAGATCTGCCCCCTTCAGG - Intronic
942728170 2:179033488-179033510 TAGAAAGATCTGTTACCTTCTGG + Intronic
943624585 2:190184367-190184389 TACATAGTTCTGCCTCTTGCAGG - Intronic
944302482 2:198139473-198139495 TACAGGCATCTGCCTACTTCAGG + Intronic
944810508 2:203322924-203322946 TACAAGTAGCTGCCTCCTTCTGG - Intergenic
945454018 2:210028113-210028135 TACACAGATCTGCTCCCTACTGG - Intronic
946498547 2:220220886-220220908 AACAAAGATCTGTCTCCAGCAGG + Intergenic
947211371 2:227711618-227711640 AACGAAGATCTGTTTCCTTCTGG - Intronic
948556149 2:238812953-238812975 TCCAGAGAACTGTCTCCTTCTGG - Intergenic
1169624661 20:7551069-7551091 ACCAAAGATGTGCCTCCTTCAGG + Intergenic
1170566712 20:17611856-17611878 TGCAGAGTTCTGCCTCCTGCAGG + Intergenic
1171878755 20:30601080-30601102 TAAAAAGATTTGCACCCTTCAGG + Intergenic
1175320852 20:58087217-58087239 GACCAAGATCTACCTCCTCCAGG + Intergenic
1182143966 22:27985373-27985395 TATAAGCATCTGCTTCCTTCGGG + Intronic
1183199297 22:36374857-36374879 AACAAAGCTCTGCCTGCGTCTGG + Intronic
1184414627 22:44345136-44345158 TAGAAAGCTCTCCCTCCTTCAGG + Intergenic
949333191 3:2945138-2945160 TACCCAGATTTCCCTCCTTCAGG - Intronic
950103583 3:10374369-10374391 TACACAGAACTGCCACTTTCTGG + Intronic
953006520 3:38984271-38984293 TGCTAGTATCTGCCTCCTTCTGG + Intergenic
956950457 3:74275870-74275892 AACAAATATCTGCTGCCTTCAGG + Intronic
962620667 3:137174894-137174916 GACAAAATCCTGCCTCCTTCAGG + Intergenic
965081924 3:164044255-164044277 TAAAAATATCTGTCTCCTTTGGG - Intergenic
968213505 3:196868437-196868459 TAGACCGCTCTGCCTCCTTCCGG + Intronic
971273131 4:25170350-25170372 TTCAAGGATCAGCCTCCCTCTGG + Intronic
972146899 4:36039170-36039192 TGCAGAGCTCTGCCTCCCTCTGG + Intronic
979202821 4:117999116-117999138 AACAAAGCTCTCACTCCTTCGGG + Intergenic
979949963 4:126880067-126880089 TATAAAGAACTGCCTCAGTCTGG + Intergenic
980993996 4:139763152-139763174 TTGAAAGATCTGCATCCTTGTGG + Intronic
981949169 4:150385448-150385470 TACAAGTATCTGCCTAATTCTGG + Intronic
984824028 4:183907689-183907711 AAAAAAGAACTGGCTCCTTCAGG - Intronic
986774005 5:10997086-10997108 TACAAATAAATGCCTCCTTAGGG + Intronic
989251351 5:39319437-39319459 TACAGAGACCAGCCTCATTCTGG - Intronic
989613652 5:43318496-43318518 TACAAAGAAATGCCTCCAACAGG - Intergenic
991171459 5:63630733-63630755 TACAATCATCTTCCTCCTTGTGG - Intergenic
992428394 5:76682774-76682796 CTGAAAGATCTGCCTCATTCTGG + Intronic
994169264 5:96640835-96640857 TGCAAAGGTCTGCCCCCTTTGGG - Intronic
995999265 5:118339337-118339359 AACAAAGATCTGTTTCCTTTAGG + Intergenic
997769090 5:136536512-136536534 TACAAAGATAGGACCCCTTCAGG + Intergenic
1000908056 5:166987620-166987642 AACAATGATCTGCATCCTCCTGG - Intergenic
1001804792 5:174574177-174574199 CACAAAGCTCTGCCTGCTTCAGG - Intergenic
1003139871 6:3462140-3462162 TCTAATAATCTGCCTCCTTCAGG - Intergenic
1007387252 6:41528303-41528325 TCCTCAGATCTGCCTCCTCCGGG + Intergenic
1008404092 6:51099764-51099786 CATAAAGATCTGCCATCTTCAGG - Intergenic
1009610110 6:65930741-65930763 TGAAAGGAGCTGCCTCCTTCAGG - Intergenic
1010495855 6:76533115-76533137 AACGCAGAGCTGCCTCCTTCTGG + Intergenic
1013629177 6:111968669-111968691 TAAATAGATCTGTGTCCTTCAGG + Intergenic
1019097243 6:169592288-169592310 TACAGAGAACTGCCTTCTTTAGG + Intronic
1021510959 7:21431923-21431945 TACATATATATGCCTACTTCAGG - Intronic
1027465947 7:78514915-78514937 TACACAGAGCTGCCTTCTCCAGG - Intronic
1028204062 7:87996124-87996146 TAGAAAGTTGTGCCTCCTACTGG - Intronic
1029159237 7:98540035-98540057 GACCAAGTGCTGCCTCCTTCAGG + Intergenic
1030577530 7:111308581-111308603 TAAAAACATCTGACTCTTTCTGG + Intronic
1031541335 7:122997922-122997944 TACAACAGTCTGCCTCCCTCAGG - Intergenic
1031976537 7:128097234-128097256 TAGAAATATCTGCCTGCTTGAGG - Intergenic
1033017312 7:137684956-137684978 CACACAGCCCTGCCTCCTTCTGG + Intronic
1033896097 7:146072569-146072591 AAGAAAGCTTTGCCTCCTTCAGG + Intergenic
1035299855 7:157889805-157889827 TATAAAGAGCTGCATCCTGCAGG - Intronic
1035785386 8:2255745-2255767 TACAAAGATATGGCTCCAGCAGG - Intergenic
1035807422 8:2465971-2465993 TACAAAGATATGGCTCCAGCAGG + Intergenic
1035947960 8:3986220-3986242 TATAAAGCTCTTCCTCCATCTGG - Intronic
1038079690 8:24119985-24120007 TGCTAAGGTCTCCCTCCTTCAGG + Intergenic
1040791522 8:51236012-51236034 TACAATGATTTGGCTCATTCAGG - Intergenic
1047287246 8:123497934-123497956 TACAAAAATATGCCACCGTCTGG + Exonic
1048165216 8:132056214-132056236 TACAAAGTGCTCCTTCCTTCGGG - Intronic
1048355731 8:133652635-133652657 AAAAAAGATCTTCCTCCTTTTGG + Intergenic
1052352520 9:27471771-27471793 TACATATGTCTCCCTCCTTCTGG + Intronic
1052581767 9:30366096-30366118 TATAAAGATCTGTTTCCTTTGGG + Intergenic
1053444130 9:38138454-38138476 AACAAAGTTCTGCCTCCCTAAGG + Intergenic
1053669622 9:40346944-40346966 TGCGGAGCTCTGCCTCCTTCTGG + Intergenic
1053919418 9:42973184-42973206 TGCGGAGCTCTGCCTCCTTCTGG + Intergenic
1054380755 9:64486964-64486986 TGCGGAGCTCTGCCTCCTTCTGG + Intergenic
1054514992 9:66029347-66029369 TGCGGAGCTCTGCCTCCTTCTGG - Intergenic
1054803323 9:69374720-69374742 GACAAAGATCTGACCTCTTCAGG + Intronic
1055943145 9:81669321-81669343 TAAAAAGCCCTCCCTCCTTCTGG + Intronic
1056878822 9:90368478-90368500 TAAAAAGAACTGCCAGCTTCAGG + Intergenic
1057265707 9:93616317-93616339 TAAAAAGATTTGCACCCTTCAGG - Intronic
1057345306 9:94245410-94245432 CACAAAGATATGCTTGCTTCAGG + Intergenic
1059286670 9:113178666-113178688 TGAGAAGATCTGTCTCCTTCAGG + Exonic
1060916074 9:127391605-127391627 TAGAAAGATCACCTTCCTTCTGG + Intronic
1061083717 9:128387119-128387141 CACTGAGATCTGCCTCCTTGTGG - Intronic
1187703234 X:21984409-21984431 TAAAAAAATCTACCTTCTTCTGG - Exonic
1189379316 X:40490693-40490715 TTCACAGATCTCTCTCCTTCTGG - Intergenic
1191211931 X:57893281-57893303 TACAAAGATCACACTACTTCAGG + Intergenic
1198410423 X:136361625-136361647 TACAAAGATCTACCTAATTGGGG + Intronic
1198911061 X:141615013-141615035 TACAAAGCCCTGCCACCTTGAGG - Intronic