ID: 923234785

View in Genome Browser
Species Human (GRCh38)
Location 1:232021973-232021995
Sequence CTTCCTCACAACATGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 608
Summary {0: 1, 1: 6, 2: 38, 3: 172, 4: 391}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923234782_923234785 -5 Left 923234782 1:232021955-232021977 CCGTCCATGTAGCTGGGGCTTCC 0: 1
1: 1
2: 10
3: 182
4: 4772
Right 923234785 1:232021973-232021995 CTTCCTCACAACATGGAGACTGG 0: 1
1: 6
2: 38
3: 172
4: 391
923234783_923234785 -9 Left 923234783 1:232021959-232021981 CCATGTAGCTGGGGCTTCCTCAC 0: 1
1: 3
2: 27
3: 139
4: 1366
Right 923234785 1:232021973-232021995 CTTCCTCACAACATGGAGACTGG 0: 1
1: 6
2: 38
3: 172
4: 391
923234781_923234785 -4 Left 923234781 1:232021954-232021976 CCCGTCCATGTAGCTGGGGCTTC 0: 1
1: 0
2: 6
3: 47
4: 388
Right 923234785 1:232021973-232021995 CTTCCTCACAACATGGAGACTGG 0: 1
1: 6
2: 38
3: 172
4: 391
923234777_923234785 14 Left 923234777 1:232021936-232021958 CCAGACATCTACAAACAGCCCGT 0: 1
1: 0
2: 0
3: 7
4: 102
Right 923234785 1:232021973-232021995 CTTCCTCACAACATGGAGACTGG 0: 1
1: 6
2: 38
3: 172
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923234785 Original CRISPR CTTCCTCACAACATGGAGAC TGG Intronic
900937809 1:5777844-5777866 CTTCCTCACAATATGGAAGTTGG + Intergenic
901681201 1:10913847-10913869 CTTCCTCACAGCATGGCGGCTGG + Intergenic
901780585 1:11591902-11591924 CTTCCTCACAGCATGGTGGCTGG - Intergenic
901873092 1:12149954-12149976 CTTCCTCACAGCATGGCTGCTGG + Intergenic
902314765 1:15609907-15609929 CTTCCTCACAGCATGGCTGCTGG + Intergenic
903059028 1:20656601-20656623 CTTCCTCAGACCATTTAGACAGG - Intronic
903699678 1:25237483-25237505 CTTCCTCAAAGCATGGGGGCTGG + Intergenic
905144667 1:35878576-35878598 CATCCTCAGAACTTGGAGGCTGG + Intronic
905707014 1:40068054-40068076 CTTCCTCAGAAGATGCATACTGG + Intronic
907592979 1:55693484-55693506 CCTCTTCACAACATGGTGGCTGG + Intergenic
907657678 1:56360679-56360701 CTTCCTCACAGCATGGCAGCTGG + Intergenic
907950858 1:59182354-59182376 TGTCCTCACAACATGGTGGCTGG - Intergenic
908013204 1:59804364-59804386 CTTCCCTACAACATGGAACCAGG + Intergenic
910402832 1:86854443-86854465 CTTCCTCACAGCATGGTGATTGG - Intergenic
911141126 1:94503678-94503700 CTTCCTCACTTCATGCAAACAGG + Intronic
912211683 1:107563690-107563712 CTGCCTCACAACATGGCAGCTGG - Intergenic
913681063 1:121187094-121187116 CTTCCGCACAACATGGTGTGGGG - Exonic
913697693 1:121343668-121343690 ATTCCTCACAAGATGTAGTCAGG + Intronic
914032893 1:143974734-143974756 CTTCCGCACAACATGGTGTGGGG - Intergenic
914139863 1:144936383-144936405 ATTCCTCACAAGATGTAGTCAGG - Intronic
914156553 1:145093232-145093254 CTTCCGCACAACATGGTGTGGGG + Exonic
914680368 1:149934662-149934684 CTTCCTCAGGTCATGGGGACTGG + Intronic
914856546 1:151355910-151355932 CTCCCTCACAACATGGTAGCTGG - Intergenic
914943815 1:152046169-152046191 CTTCCTCACAGCATGGTGGATGG - Intronic
915284988 1:154846877-154846899 CTACCTCACAACATAGTGATAGG - Intronic
915775730 1:158483843-158483865 CTTTCTCACAACATCATGACTGG + Intergenic
916042698 1:160974782-160974804 CTTCCTTACAACATGGAGGCTGG - Intergenic
916927819 1:169541544-169541566 CTTCCTCAGAACATGAAGTCTGG - Exonic
917970624 1:180204379-180204401 CTTCCTCACGGCATGGTGGCTGG + Intergenic
918052996 1:180990859-180990881 CTTCCTCACATGAAGAAGACAGG + Intronic
918992962 1:191721995-191722017 CCTTCTCACAACATGGTGACCGG + Intergenic
919151477 1:193705902-193705924 CTTCCTCACAGCATGGTGGCTGG + Intergenic
919986221 1:202677437-202677459 CTTCCTCACAGCATGGTGGCTGG - Intronic
920468375 1:206205618-206205640 CTTCCGCACAACATGGTGTGGGG - Intronic
920485085 1:206362318-206362340 ATTCCTCACAAGATGTAGTCAGG + Intronic
920555295 1:206899906-206899928 CTTCCTCACCACATGGAATATGG + Intronic
922175556 1:223194551-223194573 CTTCCTCACAGCATGGTAGCTGG - Intergenic
922234648 1:223713421-223713443 CCTCCTCATAACATTGACACTGG + Intronic
922362001 1:224831585-224831607 CTTCCCCACAACATGGTGGCTGG - Intergenic
922541159 1:226421040-226421062 ATTCCTCACAATCTGGAGTCTGG + Intergenic
923210873 1:231803220-231803242 CTTCCTTACAACATGGCTGCTGG + Intronic
923227970 1:231956884-231956906 CTTCCTCACAAAATGGTGGCTGG + Intronic
923234785 1:232021973-232021995 CTTCCTCACAACATGGAGACTGG + Intronic
923301993 1:232650055-232650077 CTTCCTCACAATATGGAAGCTGG - Intergenic
1062862823 10:823476-823498 CTACCTCACAAAATGTATACAGG - Intronic
1062991909 10:1827227-1827249 CTTCCTCCCAACATGGAGGCTGG - Intergenic
1063506840 10:6607330-6607352 CTGCTTCATCACATGGAGACTGG - Intergenic
1063607831 10:7538581-7538603 CTTCCTCACAACATGGCGGCTGG + Intergenic
1064107443 10:12511914-12511936 CTTCTTCACGGCATGGAGCCAGG - Intronic
1065566840 10:27019994-27020016 CTTCCTCACAAGATCGGGGCTGG + Intronic
1065771479 10:29082431-29082453 CTGCCTCTCAACATGGGCACTGG - Intergenic
1066416976 10:35230816-35230838 TTTCCTCCCAACCGGGAGACAGG + Intergenic
1067055310 10:43046454-43046476 CTTCCTCACAGCATGGGACCAGG - Intergenic
1067140880 10:43655554-43655576 CTTCCTCACTCCATGGGGAGGGG + Intergenic
1067277557 10:44848716-44848738 CTTCCTCACAAGATGGTGGCTGG - Intergenic
1067295657 10:44973947-44973969 CTTTCTGACTCCATGGAGACCGG - Intronic
1068757573 10:60671760-60671782 CATCCTCACAACATGGCTGCTGG - Intronic
1069097659 10:64279075-64279097 CTTCCCCACAGCATGGCAACTGG + Intergenic
1070063801 10:73013377-73013399 CTTCTTCACAGCATAGTGACTGG - Intronic
1070313480 10:75290414-75290436 CTTCCTCACACCATGGCAGCTGG + Intergenic
1070325430 10:75385591-75385613 CTTCCTCACAGCATGGTGACTGG + Intergenic
1070668494 10:78362023-78362045 CTTCCCCACTCCAAGGAGACGGG - Intergenic
1072293612 10:93989351-93989373 CTTCCTTACAACATGGCATCTGG + Intergenic
1073475477 10:103749801-103749823 CATCCTTACAACATGGAAGCTGG - Intronic
1073494160 10:103876383-103876405 ATTCCTCACATCATGGTGTCTGG - Intergenic
1073621121 10:105049516-105049538 ATTCCTTACAACATGGAGGAGGG + Intronic
1073652058 10:105371686-105371708 CTTCCTCAGAACAGGGGGACAGG - Intergenic
1075115758 10:119626121-119626143 TGTCTTCACAACATGGTGACTGG + Intergenic
1076559458 10:131351655-131351677 CTTCCTTATAAGATGGGGACGGG - Intergenic
1076980326 11:200703-200725 CTTCCTCACAACATGATGGCTGG - Intronic
1077898964 11:6474556-6474578 CTTCCTCACACCAAAGACACTGG + Intergenic
1078138003 11:8668533-8668555 CTTGCTCATAGCATGGAGATTGG + Intronic
1078500708 11:11872268-11872290 CTTCCTCACAGCATGGAGGCTGG + Intronic
1080814293 11:35738930-35738952 TTTCCTTCCACCATGGAGACTGG - Intronic
1081367787 11:42257699-42257721 CTTTCTCACAACATGGTGGCTGG - Intergenic
1081762006 11:45583217-45583239 CTTTCTCACAACATGGCAGCTGG - Intergenic
1082901276 11:58255939-58255961 CTTCCACAGAAAATTGAGACAGG - Intergenic
1083639565 11:64138198-64138220 CTTCCTCCTAACAAGGAGGCAGG - Intronic
1084126438 11:67102193-67102215 CTTCCTCAGAACCTGGGGAGAGG - Intergenic
1085042871 11:73336919-73336941 CTTCCCCACAACGTGGAGGCTGG + Intronic
1086111092 11:83199072-83199094 CTTCCTCACAATATGGTGACTGG + Intronic
1087278090 11:96180438-96180460 CTTCTTCACAACATAGTGGCTGG - Intronic
1087335206 11:96835485-96835507 ATCCCTCACAATCTGGAGACAGG + Intergenic
1088418841 11:109620110-109620132 CTTCCTCACAGGGTGGAGGCTGG - Intergenic
1088453808 11:110012451-110012473 CATCTTCATAACATGGTGACTGG + Intergenic
1088499154 11:110465258-110465280 CTTCCTCACAACCTGGCGCCTGG + Intergenic
1088937616 11:114419481-114419503 CTTCCTCACAGCATGGTGTCTGG + Intronic
1090964530 11:131586450-131586472 CTTCCTCACAACATGGCAGCTGG - Intronic
1090964694 11:131588256-131588278 CTTCCTCACAACATGGCAGCTGG + Intronic
1092021688 12:5208094-5208116 CCACCTAACAACATGGAGGCTGG - Intergenic
1092702855 12:11252168-11252190 CTTCCTCACGACATGTGGACAGG + Intergenic
1093167237 12:15818074-15818096 CTTCCTCACAACATGGCAGTTGG + Intronic
1093511671 12:19936476-19936498 CTGCCTCACAACATGGCAGCTGG - Intergenic
1093779778 12:23121850-23121872 GTTCCTCACAGTATGGACACTGG + Intergenic
1094048169 12:26190322-26190344 TATCCTCACAACATGGTGGCTGG - Intronic
1094821304 12:34228051-34228073 CTTGCTCCCAACAGAGAGACTGG - Intergenic
1095402225 12:41827962-41827984 CTTCCTCACATCGTGGTGGCTGG - Intergenic
1095486933 12:42695142-42695164 CTTCCTCACAGCACTGAGGCTGG - Intergenic
1095493838 12:42763837-42763859 CTTCTTCACAAAATGGTGGCTGG + Intergenic
1097983391 12:65757305-65757327 CTTCCTCACAGCATGGTGACAGG - Intergenic
1098199637 12:68040998-68041020 CTTCCTCACAGCATGGTAGCTGG + Intergenic
1098482173 12:70976541-70976563 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1098976277 12:76905324-76905346 CTTCCTCACAACATGGTGGTTGG - Intergenic
1099021418 12:77409285-77409307 CTTCTTCACAAGATTGTGACAGG - Intergenic
1099651061 12:85428942-85428964 CTTTCTCACAACATAGTGGCTGG + Intergenic
1100615379 12:96227552-96227574 CTTCCTGACAGCATGGGCACAGG - Intronic
1101517569 12:105451139-105451161 CTTCCTCTCTACATGTATACAGG + Intergenic
1101933965 12:109040742-109040764 CATCTTCACAACATGGTGACTGG + Intronic
1102185587 12:110945748-110945770 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1102200816 12:111056526-111056548 CTTCCTCACAGCATGGTGGCTGG + Intronic
1102234483 12:111285731-111285753 CTTCACCACAACACGGAGGCAGG - Intronic
1102426018 12:112845009-112845031 TGTCCTCACAACATGGCGGCTGG + Intronic
1102554365 12:113717188-113717210 CTTCCTCACAGTATGGTGGCTGG - Intergenic
1102594981 12:113985454-113985476 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1102637942 12:114340882-114340904 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1102727326 12:115077242-115077264 CTTCCTCACAGTATGGAGACTGG - Intergenic
1102809629 12:115813160-115813182 CTTCCTCACAGCATAGAGACTGG - Intergenic
1102819015 12:115892241-115892263 CTTCCTGACAGCATGGTGCCTGG - Intergenic
1102894132 12:116585015-116585037 TGTCCTCACAACATGGTGGCTGG - Intergenic
1102932693 12:116874751-116874773 CTTCCTCACAGCATGGCAGCCGG - Intronic
1103055403 12:117816239-117816261 CTTCCTCACAGCATGGTGGTTGG - Intronic
1103202343 12:119098104-119098126 TATCCTCACAACATGGCGGCTGG - Intronic
1103279314 12:119742185-119742207 CTTCCCCAAAACATGAAGAATGG + Intronic
1103885591 12:124197852-124197874 CTTCCTTACAGCATGGTGGCTGG - Intronic
1104064279 12:125293962-125293984 CTTCCTCACAGCATGGCAGCTGG - Intronic
1104382757 12:128322193-128322215 CTTCCTCACAACATGGTGGCTGG - Intronic
1104641052 12:130467531-130467553 CTTCCTGAGAATTTGGAGACTGG - Intronic
1105627742 13:22129629-22129651 CTTCCTCACAACATGGCAGCTGG + Intergenic
1106146048 13:27050740-27050762 CTTCCTCACAGTATGGCGGCTGG - Intergenic
1106174729 13:27320541-27320563 CTTCCTCCCAACATGGTGGCTGG + Intergenic
1106236220 13:27862740-27862762 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1107589501 13:41887537-41887559 CAGGCTCACAACATGAAGACTGG + Intronic
1108040267 13:46333352-46333374 CTTCCTCACACCATGGGGGCAGG - Intergenic
1109346363 13:61119009-61119031 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1113894366 13:113754429-113754451 CTTCCTCATGACATGGGGGCTGG - Intergenic
1115233925 14:31190023-31190045 CTTCCTCACAGGATGGTGACTGG - Intronic
1115653612 14:35421912-35421934 CTTCCTCAGTACATGGAATCAGG - Intergenic
1115710799 14:36048887-36048909 CTTCCTCACAGGATGGTGGCTGG + Intergenic
1116091876 14:40318449-40318471 TTTCCTCACAGCATGGTGACTGG - Intergenic
1116397645 14:44465592-44465614 CTGTCTCACAGCCTGGAGACAGG + Intergenic
1118169308 14:63370903-63370925 CTTCCTCACAGCATGGCAGCTGG - Intergenic
1118492966 14:66279738-66279760 CTTCCTCACAGTATGGTGGCTGG - Intergenic
1119281167 14:73409337-73409359 CTTCTTCACAGCATGGTGCCTGG - Intronic
1119701632 14:76759851-76759873 CTTCTTCACAACATGGTAGCTGG + Intergenic
1119854638 14:77890356-77890378 CTTCCTCACAGCATGGCGGCTGG + Intronic
1119921477 14:78450537-78450559 CTTCCTCCCTACCTGGAGCCCGG + Intronic
1120055798 14:79922740-79922762 CTTCCTCATAGCATGGTGACTGG + Intergenic
1120220587 14:81728181-81728203 CGTCCTTACAACATGGTGGCTGG + Intergenic
1120332195 14:83107810-83107832 CTTCCTCAGAGCATGGGGAATGG - Intergenic
1120834050 14:89024920-89024942 CTTCCTCACAGCATGGCGGCTGG + Intergenic
1121435154 14:93914434-93914456 CTTCCTCACAGCATGGCGGCTGG - Intergenic
1123115335 14:105891890-105891912 CTACCTCACAACCCGGAGACAGG + Intergenic
1123156478 14:106232095-106232117 CATCCTCACAACAAGGTGACAGG + Intergenic
1123482399 15:20644265-20644287 CTTCCTCCCAGCAAGGAGACAGG + Intergenic
1124608632 15:31192588-31192610 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1126380234 15:48038967-48038989 CTTCCTCACAACATGGCAGCTGG + Intergenic
1126913219 15:53436884-53436906 CTTCTTCACAACATGATGGCAGG + Intergenic
1127214416 15:56809615-56809637 CTTCCTCATAGCATGGCGGCTGG + Intronic
1127582887 15:60353783-60353805 CGTCCTCACAACATGGCAGCCGG - Intronic
1127787991 15:62373039-62373061 CATCCTCACAACATGGCAGCTGG - Intergenic
1128144178 15:65323226-65323248 CTTCCTCACAGCATAGTGGCTGG - Intergenic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1129898277 15:79124653-79124675 CTTCCTCACAGTATGGTGGCTGG - Intergenic
1130150705 15:81309382-81309404 CCTCCTCACAACATGGTGTCTGG + Exonic
1131342107 15:91612014-91612036 CTTTCTCACAACGTGGTGGCTGG - Intergenic
1131412693 15:92223695-92223717 CATCCTCACAGCATGGTGTCTGG + Intergenic
1131452866 15:92560759-92560781 CTTCCTCACAGCATGGCATCTGG - Intergenic
1131473647 15:92717528-92717550 CTTCCTCACAGCATGGCAGCTGG - Intronic
1131487539 15:92834089-92834111 CTTCCTCACAACATGGTCCCTGG - Intergenic
1132405403 15:101539144-101539166 CTTCCTCACAACATGGTGGCTGG - Intergenic
1133455559 16:5939513-5939535 CATCCTCACAACATGGCTGCTGG + Intergenic
1133795439 16:9042632-9042654 CTTCCTCACAGCATGGCGGCTGG - Intergenic
1133817162 16:9206767-9206789 CTTCCTCACAGCATGATGGCTGG - Intergenic
1133926121 16:10194010-10194032 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1133944727 16:10338708-10338730 CTTCCTCACAGCATGGTGGCTGG + Intronic
1134763482 16:16734756-16734778 CTTCCTCACTACATGGTGGCTGG + Intergenic
1134763699 16:16737051-16737073 CTTCCTCACAACATAGTAGCTGG + Intergenic
1134982355 16:18622106-18622128 CTTCCTCACAACATAGTAGCTGG - Intergenic
1134982570 16:18624401-18624423 CTTCCTCACTACATGGTGGCTGG - Intergenic
1135654598 16:24236764-24236786 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1135662778 16:24311007-24311029 CTGCTTCCCAACATGGAAACGGG - Intronic
1136104584 16:28020760-28020782 CGTCCTCACAACATGGCAGCTGG - Intronic
1137337012 16:47559638-47559660 CTTCCTAACAGCATGGTGGCTGG + Intronic
1137750394 16:50857290-50857312 CTTCCTTACAATGTGGAGCCTGG + Intergenic
1137774125 16:51041417-51041439 CTTCCTCACAGCATGGCCAGTGG - Intergenic
1138155740 16:54701441-54701463 CTTCCTCACAACATGGTGGCTGG - Intergenic
1140322150 16:73963340-73963362 CTTCCTCCCAAGATGGCGGCTGG - Intergenic
1140767704 16:78175530-78175552 TTTCCTCACAACATGGTGGCTGG - Intronic
1140837253 16:78806607-78806629 CTTCCTCACAATATGGCGGCTGG + Intronic
1141010731 16:80395949-80395971 CTTCCTCACAACATGGTGGCTGG + Intergenic
1141349338 16:83278475-83278497 ATTCTTCACACCATGGAAACTGG - Intronic
1141475556 16:84270767-84270789 CTTCCTCACAGCATGGCGGCCGG + Intergenic
1141638278 16:85327131-85327153 CTTCCTCACAACATGGTGGCAGG + Intergenic
1141783427 16:86181268-86181290 CATACACAGAACATGGAGACTGG + Intergenic
1141903686 16:87008825-87008847 CTTCCTCACATCATGGCTGCTGG - Intergenic
1142109612 16:88324166-88324188 CTTCCTCACAGCATGAGGGCTGG + Intergenic
1143093709 17:4465251-4465273 CTTCCTCACAGCATGGTGGCCGG + Intronic
1143967737 17:10768817-10768839 CTTCCTTCCAACATGGTGGCTGG - Intergenic
1144328051 17:14200526-14200548 CTTCCTCAGAAAATGGAGAAGGG - Intronic
1144549373 17:16226381-16226403 CTTCCTCACAACCTGGTGGCTGG + Intronic
1144613011 17:16741434-16741456 CTTCCTCACAGCATGGGGGCTGG + Intronic
1144887435 17:18472842-18472864 CTTCCCCACAATATGGTGGCTGG - Intergenic
1144899789 17:18574288-18574310 CTTCCTCACAGCATGGGGGCTGG - Intergenic
1145132672 17:20371511-20371533 CTTCCTCACAACATGGGGGCTGG + Intergenic
1145144781 17:20471452-20471474 CTTCCCCACAATATGGTGGCTGG + Intergenic
1145246578 17:21273612-21273634 CTTCCTCATAGCATGGCAACAGG - Intergenic
1145897382 17:28467286-28467308 CCTCCTCACAACATTGAGCTAGG + Intronic
1145911735 17:28547156-28547178 CTTCCTCCCAACATTGACTCAGG + Exonic
1146354146 17:32119930-32119952 CTTCCCCACAATATGGTGGCTGG - Intergenic
1146686234 17:34843329-34843351 TGTCCTCACAACATGGCGGCTGG - Intergenic
1146797394 17:35792332-35792354 CTTCCTTATAACATGGTGTCTGG - Intronic
1147017331 17:37502760-37502782 CTTCCTCACAGCATGGCAGCTGG + Intronic
1149238846 17:54624839-54624861 CATCCTCACAACATGACGACTGG - Intergenic
1149321225 17:55483406-55483428 CTTCCTAGCAACATCTAGACTGG - Intergenic
1149400039 17:56286587-56286609 CTTCCTTACAACATGGCGGCAGG + Intronic
1149438663 17:56656211-56656233 CTTCCTCACATCATGGTGCCTGG + Intergenic
1149440565 17:56670334-56670356 CTTCCTCACACCATGGAGATTGG + Intergenic
1149441029 17:56673982-56674004 CCTCCTCACCACATGGTGACTGG + Intergenic
1150469812 17:65427355-65427377 CTTCCTTACAGCATGGTGGCTGG + Intergenic
1151170784 17:72244194-72244216 CTTCCTTACAACATGGCAGCTGG - Intergenic
1151339383 17:73460192-73460214 CTTCCTCACAACATGGTGACTGG - Intronic
1151432675 17:74074726-74074748 GTTCCTCACAACATGGCAGCTGG - Intergenic
1152201678 17:78950887-78950909 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1153960236 18:10134153-10134175 CTTCCTTAAAACAAGGACACAGG + Intergenic
1155149425 18:23111265-23111287 CTTCCTCACAATATGGTGGCTGG - Intergenic
1155166240 18:23234722-23234744 CTTCAGCACAACTTGGTGACTGG - Intronic
1156044698 18:32864412-32864434 TTTCCTCACAGCCTGGAGGCTGG - Intergenic
1156967189 18:43108411-43108433 CTTCCTCACAAGATCAAGGCAGG + Intronic
1157450180 18:47780422-47780444 CTTCCTCATAGCAAGGAGGCTGG - Intergenic
1157547818 18:48559722-48559744 CTTCCTCAAAGCATGGTGGCTGG + Intronic
1157622998 18:49026883-49026905 CTTCCTAACATCGTGGAGTCAGG + Intergenic
1157777782 18:50409563-50409585 CTTTCTCACAACGTGGTGGCAGG - Intergenic
1158406328 18:57163038-57163060 CTTCCTCACAGCATGGTTGCTGG - Intergenic
1158703188 18:59767404-59767426 CTTTCTCACAATCTGGAGGCTGG - Intergenic
1159034041 18:63259999-63260021 CTTCCTCACAATATGTTGAGAGG - Intronic
1159584269 18:70268361-70268383 TTTCCTCACAAGATGGTGACTGG + Intergenic
1161254932 19:3303007-3303029 CATCCTTACAACATGGTGGCTGG + Intergenic
1161291728 19:3497364-3497386 CATCCTCACAACATGGTCACTGG - Intronic
1161529764 19:4781037-4781059 CTTCCTCACAAGATGGCTGCTGG - Intergenic
1161860555 19:6795010-6795032 CTTCCCCACAACATGGCGACCGG + Intronic
1161872292 19:6879465-6879487 TCTCCTTACAACATGGCGACTGG + Intergenic
1161874443 19:6896870-6896892 TTTCCTCACAATATGGTGGCTGG + Intronic
1161874579 19:6898036-6898058 TTTCCTCACAATATGGTGGCTGG + Intronic
1162783802 19:13021781-13021803 CTTCCTCACAGCAAGCAGAAAGG - Intronic
1163151302 19:15416409-15416431 TATCCTCACAACATGGTGGCTGG - Intronic
1163679754 19:18674202-18674224 ATTTCTCATAACAAGGAGACTGG + Intergenic
1164870934 19:31642140-31642162 CCTCCTCACAACATGGCAGCTGG - Intergenic
1165301505 19:34972589-34972611 CTTCCTCACAGCATGGAGACTGG + Intergenic
1166972801 19:46581500-46581522 CTTCCTCACAACATGGTGGCTGG + Intronic
1167036652 19:46998921-46998943 CTTCCTGACCAGATGGAGACGGG - Intronic
1167170366 19:47827001-47827023 CATCCTCACAACATGGCGGCTGG + Intronic
1167638749 19:50668874-50668896 CATCCTCCCGAGATGGAGACAGG - Exonic
1167673295 19:50868861-50868883 AATCCTCACAACATGGCTACAGG + Intronic
1168614678 19:57828003-57828025 CTTCCTGAAAACTTGGAGACTGG - Intronic
925031815 2:655720-655742 CTGCCTCACAACAAGGTGGCTGG - Intergenic
925818235 2:7774181-7774203 ATTCCTCTCAACATAGAGTCTGG - Intergenic
926400902 2:12495464-12495486 CTTTCTCACAACCTGGATCCTGG + Intergenic
926684299 2:15686866-15686888 CTTCCTCACTGCATGGAGCCTGG + Intergenic
926733123 2:16052096-16052118 CTTCCTCACAGCATGGTGGCTGG + Intergenic
927137875 2:20110594-20110616 CTTCCTCACAGCATGGTGGCTGG + Intergenic
927338868 2:21957438-21957460 GTTTCTCATAACATGGTGACTGG + Intergenic
928053421 2:28025698-28025720 CATCATAACAACATGGAGGCTGG - Intronic
928272480 2:29868915-29868937 CTTCATCACAACATGGTGGCAGG - Intronic
929027468 2:37618413-37618435 CTTCCTCACAACATGGCAGCTGG + Intergenic
929270668 2:39968001-39968023 CTTCCTCACAGCATGGGGGTTGG - Intergenic
929536218 2:42785983-42786005 CTTCCTCCCAGCTTGGAGAGTGG - Intronic
929790635 2:45020116-45020138 CTTCCTTACAGCATGGTGGCTGG - Intergenic
930062375 2:47300837-47300859 CTTCCTCACTTCAAAGAGACAGG - Intergenic
930102050 2:47610870-47610892 CTTCCTCACACCATGGTGGCTGG + Intergenic
931384645 2:61787188-61787210 CATCCTCACAACATGGCAGCTGG - Intergenic
931969620 2:67571422-67571444 CTTCCTGACTACATGGAGGCTGG - Intergenic
932627089 2:73306175-73306197 CTTCCTCACAACATAGTTGCTGG + Intergenic
932707765 2:74039827-74039849 CTTCCTCACAGCATGGTGACTGG + Intronic
935813596 2:106825268-106825290 CATCCTCACAACATGGCAGCTGG - Intronic
936087472 2:109479129-109479151 CTTCCTCACAATGTGGCGACTGG + Intronic
936119368 2:109728090-109728112 CTTCCTCACAGCATGGTGGCTGG - Intergenic
936293267 2:111245282-111245304 CATCTTCATAACCTGGAGACAGG + Intergenic
936429772 2:112452215-112452237 CTACCTCACAACATAGCAACTGG + Intergenic
936503684 2:113087168-113087190 CTTCCCCACAATATGGCAACTGG + Intergenic
936519164 2:113201101-113201123 CCTCCTCCCAACCTGGAGCCAGG + Intronic
936907457 2:117553611-117553633 CATCCTCCCAACATGGACCCAGG - Intergenic
937308221 2:120885168-120885190 CTTCTGCACATCATGCAGACCGG + Intronic
939927939 2:148197204-148197226 CTTCCTCACAATATGGGGACTGG - Intronic
940197238 2:151108500-151108522 CTTCCTTGCAACATGGAGGCTGG + Intergenic
940771940 2:157848333-157848355 CTTCCTCATAGCATGGCGGCTGG - Intronic
941045469 2:160670653-160670675 CTTCCTCATAGCGTGGTGACTGG + Intergenic
941230283 2:162903684-162903706 TGTCCTCACATCATGGAGAGAGG - Intergenic
941684560 2:168435181-168435203 CTTCCTCACACCATAGTGACTGG + Intergenic
941906248 2:170717509-170717531 CTGCCTCCCAAAATGGAGCCAGG + Exonic
942212102 2:173681503-173681525 CTTCCTCACAACATGGTGTCTGG + Intergenic
942847358 2:180442738-180442760 CTACCTCACAACATGGCAATTGG - Intergenic
943724921 2:191243816-191243838 CTTCCTCACAATATGGCAGCTGG + Intergenic
945066467 2:205951606-205951628 CTTCCTCACAGCATGGCAGCTGG - Intergenic
945266984 2:207900308-207900330 CTTCCTTACAACATGGCCACTGG + Intronic
945943119 2:215969519-215969541 CTGCCTTACAATATGGAAACGGG - Intronic
946040394 2:216778224-216778246 CTTCCCCGTAACATGGAGGCTGG + Intergenic
946481737 2:220063462-220063484 ATTCCTCACACCATGGCAACTGG - Intergenic
946670011 2:222092447-222092469 CTTCCTCACAGCATGGTGGCTGG - Intergenic
946996896 2:225403249-225403271 CTTCCTCACAGCATTGAGACAGG + Intronic
947314137 2:228836623-228836645 CTTCCTCAAAGCAAGGTGACTGG + Intergenic
947528223 2:230892489-230892511 CTTCCCCACAACATGGAGACTGG + Intergenic
948069925 2:235112464-235112486 CTTCACCGCGACATGGAGACTGG - Intergenic
948182166 2:235990559-235990581 CTTCCTTCCAACATGGTGGCTGG + Intronic
948287264 2:236795584-236795606 CTTACTCATATCATGGAGAAGGG - Intergenic
948290656 2:236821883-236821905 CATCCTCACAACATGGCGGCTGG - Intergenic
948672296 2:239576259-239576281 CTTCCTCCCAACATGGCGGCCGG + Intergenic
1169034573 20:2439011-2439033 CTTCCTCACAACATGGTAGCTGG + Intergenic
1169836920 20:9890636-9890658 CATCCTCACAACATGGTAGCTGG - Intergenic
1169917581 20:10698847-10698869 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1170050702 20:12141687-12141709 ATTCCTCACAACATGGCATCTGG + Intergenic
1170408892 20:16067378-16067400 CTTCCTCCCAATATGGTGGCTGG - Intergenic
1170417888 20:16163995-16164017 CTTCCTCACAGCATGGCAGCTGG - Intergenic
1170697779 20:18675211-18675233 TGTCCTCACAACATGTGGACTGG + Intronic
1170877305 20:20262356-20262378 CTTCCTCATAACGTGGTGGCTGG - Intronic
1171022657 20:21600778-21600800 CTTCCTCACAATATGGTGGCTGG - Intergenic
1171040620 20:21759106-21759128 CCTCCTCACAACATGGCAGCTGG - Intergenic
1171311515 20:24148883-24148905 CTTCCTCACAGCATGGCAGCTGG + Intergenic
1171365539 20:24620504-24620526 CTTCCTCACAACACGGCAGCTGG + Intronic
1171406900 20:24917847-24917869 CTTCCTCACAGCCTGGTGGCCGG - Intergenic
1171502784 20:25606794-25606816 TTTCCTCTCAACATGGTGGCTGG - Intergenic
1172179220 20:32990603-32990625 CTTCCTCTCAACATGGCAGCTGG - Intronic
1172315207 20:33948677-33948699 CTTCCTCACAGCATGGCAGCTGG - Intergenic
1172880807 20:38198855-38198877 CTTCCCCACAGCATGGTGGCTGG + Intergenic
1172919582 20:38469996-38470018 CTTCCTCCCAACATGGTGGCTGG + Intergenic
1172936504 20:38624277-38624299 CTTCCTCACAGCATGGCGGCTGG + Intronic
1172946833 20:38696066-38696088 TGTCCTCACAACATGGTGACTGG + Intergenic
1172959713 20:38790109-38790131 CTTCCTCACAGCATGGCAGCTGG - Intergenic
1173012787 20:39197459-39197481 CTTCCTCACAAAATGGTGGGGGG - Intergenic
1173185131 20:40834611-40834633 CTTCCTCACAGCATGGTGGTTGG - Intergenic
1173328778 20:42057103-42057125 CTCCCGCACATCATGAAGACAGG + Intergenic
1173458004 20:43219258-43219280 TATCCTCACAACATGGCAACTGG - Intergenic
1173538066 20:43830936-43830958 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1173691330 20:44963390-44963412 CTTCCTCACAAAATAAAGCCTGG - Intergenic
1175134154 20:56810327-56810349 CTTCCTCCCAACATGGTGGCTGG - Intergenic
1176023685 20:62975225-62975247 CTTCCTCACAGCATGGTGGCCGG - Intergenic
1176106406 20:63391644-63391666 CTTCCTCACAGCATGGTGTCTGG + Intergenic
1176943284 21:14949863-14949885 CTTCCTCACAACACAGTGGCTGG + Intergenic
1178638256 21:34324074-34324096 CTTCCTCACAACATGGTGGTTGG - Intergenic
1178814808 21:35919428-35919450 CTTCCTCTCAACATGGTGGCTGG + Intronic
1179209831 21:39314910-39314932 AATCCTCACAACTTTGAGACAGG - Intronic
1179257805 21:39731990-39732012 CTTCCTCACAGCATGGCTGCTGG - Intergenic
1179293661 21:40042026-40042048 CTTCCTCACAGCATGGTGGCTGG - Intronic
1179717247 21:43295758-43295780 CTTCCTCACAACATGGCGGCTGG + Intergenic
1179837183 21:44043823-44043845 CTTCCCCACAGCATGGTGGCTGG - Intronic
1180925201 22:19549008-19549030 GTTGCTCACAACATGGCGACTGG - Intergenic
1181349767 22:22246610-22246632 CTTGCTTAAAACCTGGAGACAGG - Intergenic
1181660277 22:24341819-24341841 CTGGCTCACAACATGGGAACTGG - Intronic
1181768440 22:25109007-25109029 CATCCTCACAACATGGCGGCTGG + Intronic
1181969946 22:26682284-26682306 CTTCCTCACACCATGGTGGCTGG - Intergenic
1182021855 22:27088356-27088378 CTTCCTCACAACATGGCAGTTGG + Intergenic
1182061708 22:27403079-27403101 CTTCCTCACAACATGGCAGCTGG - Intergenic
1182271661 22:29157690-29157712 CTTCCTGAAAACACGGAGGCTGG + Intronic
1182542250 22:31050114-31050136 CTTCCTCACAGCCTGGAGAAAGG + Intergenic
1182985288 22:34710538-34710560 CTTCCTCAGAGCATGGTGGCTGG - Intergenic
1184420354 22:44378549-44378571 CTTCCTCACAACATGGCTGCTGG - Intergenic
1184608737 22:45589387-45589409 CATCCTGACAACATGGAGCACGG + Intronic
1185309607 22:50146651-50146673 CTCCCTGACAGCCTGGAGACAGG + Intronic
949573973 3:5320793-5320815 CTTCCTCCCAGCATGGTGGCTGG + Intergenic
949652943 3:6181964-6181986 CTTCCTCACAGCATGGCAACTGG + Intergenic
950291372 3:11787113-11787135 CACCCTCACAACATGGCGGCTGG + Intergenic
950445623 3:13035885-13035907 CGTCCTCAAAACATGGCGGCTGG - Intronic
950472649 3:13196138-13196160 CTTCCTCACAGCATGGTGGCTGG - Intergenic
950643827 3:14365341-14365363 CTTCCTCACAACATGGTGGCTGG + Intergenic
950698146 3:14720428-14720450 CTTCCTCACACCCTGCAGTCTGG - Intronic
950703206 3:14764737-14764759 CTTCCTCACAACATGGTGGCTGG + Intronic
950810728 3:15647712-15647734 CTTGACCACAACATGGAGACAGG + Intergenic
951444732 3:22765405-22765427 CTTCCTTACAGCATGAACACTGG - Intergenic
951774801 3:26297905-26297927 CATCCTAACAACATGGTGGCTGG - Intergenic
951919109 3:27834042-27834064 CTTCCTCACAGCATGGTGGCTGG + Intergenic
951952274 3:28213428-28213450 CTTCCTCACATCATGGCAACTGG + Intergenic
952865242 3:37850856-37850878 CTTCCTCACAACATGGTGGCTGG - Intergenic
953007979 3:38995499-38995521 CTGCCTCCCAACATGGAGGAAGG - Intergenic
953035221 3:39205271-39205293 CTTCCTCACAGCATGGTGGCTGG - Intergenic
953686408 3:45081679-45081701 CTTCTTCACAACATGGTGGCTGG - Intergenic
953697341 3:45170310-45170332 CTTCTTCACAGCATGGTGGCTGG + Intergenic
956125201 3:66004434-66004456 CTTCCTCATAGCATGGTGGCTGG + Intronic
956209410 3:66787793-66787815 CTTCCTTACAACATGGTGGCTGG + Intergenic
956746811 3:72317059-72317081 CTTCCTCACAGCCTGGCAACAGG - Intergenic
956749398 3:72334215-72334237 CTTCCTCACAGTATGGTGGCTGG - Intergenic
956767292 3:72494394-72494416 CTTCCTCACAACATGGCAGCTGG + Intergenic
956791307 3:72682198-72682220 CTTCCTCACAACATGGTGACTGG - Intergenic
956836211 3:73098200-73098222 CTTCCTCACAACATGGCAGCTGG - Intergenic
957013765 3:75038965-75038987 CCTCCTCACAAAATGGACAGAGG - Intergenic
957242943 3:77682263-77682285 CTCCCTAACAATTTGGAGACTGG - Intergenic
957275843 3:78090524-78090546 CTTCCTCACAGCATGGCAGCTGG + Intergenic
958454732 3:94316230-94316252 CTTTCCCACAACATGGTGGCTGG + Intergenic
961064741 3:123865925-123865947 CTTCCTCACAGCATGGTGGCTGG - Intronic
961243150 3:125429801-125429823 CTTCCTCACAACATGGAGGCTGG - Intergenic
961363379 3:126382279-126382301 CTTCCTCACTACATGGAGGCTGG + Intergenic
961735053 3:128996097-128996119 CTTCCTCACAACATGCTAGCTGG - Intronic
962056039 3:131872745-131872767 CTTCCTCACAACATGGTGTTTGG - Intronic
962090679 3:132241217-132241239 CTTCCTCATAGCATGGTGGCTGG - Intronic
962255867 3:133869751-133869773 CTTCCTCACAGCATGGTTGCTGG - Intronic
962399909 3:135049508-135049530 CTCCCTCACAGCATGGTGGCTGG + Intronic
962625296 3:137220077-137220099 CTTCCTTACAACATGGTGGCTGG + Intergenic
963304425 3:143635238-143635260 CTTCCTCACAGCAAGGTGGCTGG + Intronic
964334754 3:155643287-155643309 TGTCCACACAACATGGTGACTGG - Intronic
965628198 3:170703481-170703503 CTTCCTCACAGCATGGTGGCTGG + Intronic
965902057 3:173653868-173653890 CTTCCTAACAGCATGGTGTCTGG - Intronic
967044573 3:185724957-185724979 CTTCCTCACAGCATGGTGGCTGG - Intronic
967208301 3:187144437-187144459 CTTCTTCACAAGGTGAAGACAGG + Intronic
969328608 4:6459312-6459334 CTTCCTCACAATATGGTGGCTGG + Intronic
969582861 4:8076023-8076045 CTTCCTCACATCAATGAGAATGG + Intronic
969967157 4:11008794-11008816 CTTCCTCACAGCATGGCAGCGGG + Intergenic
970519418 4:16867094-16867116 CTTCCCCACAGCATGGAGGCTGG - Intronic
972093048 4:35312703-35312725 CTTCCTCAGAGCATGGCGACTGG - Intergenic
972286506 4:37653802-37653824 CTTCCTCACAGCATGGTGGCTGG - Intronic
972944703 4:44240082-44240104 CTTCTTCCCATAATGGAGACTGG - Intronic
972973872 4:44609975-44609997 CTCCCTGAAAACTTGGAGACTGG - Intergenic
973635643 4:52859916-52859938 CTCTCTCACAACATGGTGACGGG - Intergenic
974125251 4:57688078-57688100 CTTCCCCACAGCATGGTGACTGG + Intergenic
974636551 4:64570847-64570869 GTTCCTGACAACATGGTGGCTGG + Intergenic
974711325 4:65599927-65599949 CATCCTCGAAACATGGAGAGAGG + Intronic
974771517 4:66420758-66420780 CTTCCTCACAATATGGTAACTGG + Intergenic
974873144 4:67668619-67668641 CATCCTCACAAACTGGAGACAGG - Exonic
975000856 4:69222462-69222484 CTTACTCAGATCATGGAGACTGG - Intergenic
975004597 4:69269806-69269828 CTGACTCACATCATGGAGATTGG + Intergenic
975013009 4:69378777-69378799 CTTACTCAGATCATGGAGATAGG + Intronic
975504715 4:75125151-75125173 CTTCCTCCTAGCATGGAGACTGG - Intergenic
976864010 4:89702366-89702388 CTTCCTCACAACATGGTGGCTGG + Intergenic
977710188 4:100115695-100115717 GCTTCTCACAACATGGAAACGGG - Intergenic
977864212 4:102003516-102003538 CTACCTCACAGCATGGTGGCTGG + Intronic
979108340 4:116716969-116716991 TTTCCTCACAACAAGAAGGCTGG - Intergenic
979439890 4:120739133-120739155 GGTCCTCACAACATGGTGATTGG + Intronic
980007468 4:127558909-127558931 CTTCCTCACAACCTGGGGTGGGG - Intergenic
980189162 4:129501354-129501376 GTTCCTCACAGCATGGTGCCTGG + Intergenic
980888465 4:138788537-138788559 TTTCCTCACAGCATGGTGACTGG + Intergenic
980973519 4:139588834-139588856 CTTCCTAACTGCATGGTGACTGG - Intronic
981688305 4:147479973-147479995 CTTCCTCACAGCATGGTGGCGGG - Intergenic
981850552 4:149224668-149224690 CTTTCTCACAACATGGTGCAGGG - Intergenic
984961863 4:185105168-185105190 CTTGCTCACAACATGTAGAGTGG - Intergenic
985866784 5:2520108-2520130 CATCCTCAGAGCATGGAGATGGG + Intergenic
986247411 5:6022823-6022845 CTTCCTCACAGCATGGCAGCTGG - Intergenic
986296423 5:6443153-6443175 CTTCCTCTCACCATGGCGTCTGG + Intergenic
986296632 5:6444724-6444746 CTTCCTCTCAACATGGTGTCTGG + Intergenic
986667905 5:10119082-10119104 CTTCCTCACAACATGGCTGCTGG + Intergenic
987055692 5:14189291-14189313 CTTCATCAAACCATGGGGACAGG - Intronic
987265114 5:16245376-16245398 CATCCTCACAGCATGGTGGCTGG - Intergenic
988663769 5:33302349-33302371 CTTCCTCACAGCATGGCAGCTGG + Intergenic
988724414 5:33911677-33911699 CTGCCTCACAGCATGGCAACTGG - Intergenic
988803570 5:34719265-34719287 CTTTCTCACAGCATGGTGGCTGG + Intronic
989625554 5:43426256-43426278 CTACCTCACAGCACGGTGACTGG + Intergenic
990314835 5:54574261-54574283 CTTCCTCACAGCATAGTGGCTGG + Intergenic
990335902 5:54772564-54772586 CTTCCTCAGAACATGGAGGCTGG + Intergenic
990866867 5:60389719-60389741 CTTCTTCACAACATGTTGGCTGG + Intronic
991618528 5:68520911-68520933 CTTCCTCAGATCATGGTGATTGG + Intergenic
991948768 5:71927456-71927478 CTTCCTCACAGCATGGAGGCAGG - Intergenic
991994574 5:72374646-72374668 TGTCCTCACAACATGGTGTCTGG - Intergenic
992084250 5:73263835-73263857 CTTCATCCCATCATGGAGCCTGG + Intergenic
993468661 5:88279680-88279702 TTTTCTCACAACATGGCAACTGG + Intergenic
993933086 5:93966976-93966998 CTCCCTCAAAAGATGTAGACAGG - Intronic
994321754 5:98402822-98402844 GTTGCTCACAACATGGTAACTGG + Intergenic
997432641 5:133851348-133851370 CTTTCTCCCATCTTGGAGACTGG - Intergenic
998031148 5:138869122-138869144 CTTCCTATCAACACTGAGACTGG - Exonic
998424734 5:142016824-142016846 CTTCCTCACAACATAGCGGTGGG + Intergenic
999623115 5:153491770-153491792 CATCCTCTCAACTTGGAGGCAGG + Intronic
999630377 5:153564634-153564656 CTTCCTCACAACATGGTGACTGG + Intronic
999802347 5:155049784-155049806 CTTCCTCACCACAGAGAGGCTGG + Intergenic
1000369049 5:160517477-160517499 CTTCCTCACAACATGGTGGTTGG + Intergenic
1001827641 5:174758751-174758773 CATCCTCACAACATGGCAGCTGG - Intergenic
1003152609 6:3565230-3565252 CTTCCTCACAGCATGGTAGCTGG + Intergenic
1003332584 6:5142266-5142288 CTTCCTCACAACATGGCGGCTGG - Intronic
1003707120 6:8545299-8545321 CATCCTCACACAATGAAGACAGG - Intergenic
1004918343 6:20353303-20353325 CTTCCTCACAACATGGCCGCTGG - Intergenic
1005689391 6:28287624-28287646 CTTCTTCACAAAATGGACTCTGG + Intronic
1005885844 6:30097120-30097142 CTCCCACACAACATGGGGCCAGG - Intergenic
1006011525 6:31046449-31046471 CTACCTCACAACATGAAAACAGG - Intergenic
1006392143 6:33764640-33764662 ATTCCTCAGCACATGGAGGCAGG + Intergenic
1006919977 6:37621148-37621170 CTTTCTCCCAGCATGGTGACTGG + Intergenic
1007102693 6:39260977-39260999 CTTCCTCAAGACAGGGAGCCTGG + Intergenic
1007106032 6:39283608-39283630 CTTCCTGACAACACGGCGGCTGG - Intergenic
1007296364 6:40824644-40824666 CTTCCTCCCTGCATGTAGACGGG - Intergenic
1007305916 6:40904401-40904423 ATTTCTCACAACCTGGAGGCTGG - Intergenic
1007488550 6:42199626-42199648 CTTCCTCACAACATGGTGGCTGG - Intergenic
1007506350 6:42338129-42338151 CTTCCTCACAGCAGTGAGCCAGG - Intronic
1007649059 6:43406151-43406173 CATCCTCACAATATGGCAACTGG - Intergenic
1007989200 6:46237804-46237826 CTTCCTTACAACTTGGACATAGG - Intronic
1008151270 6:47954920-47954942 CTTCCTCACAACATGGTGGCTGG - Intronic
1008465459 6:51825427-51825449 CTTCCTCACAGCATGATGGCTGG - Intronic
1009041409 6:58183528-58183550 CTTCCTCAGAAAATGAAGCCAGG - Intergenic
1009217262 6:60937843-60937865 CTTCCTCAGAAAATGAAGCCAGG - Intergenic
1012746938 6:103103353-103103375 CTGGCTAACAACATGGTGACAGG - Intergenic
1015313091 6:131786409-131786431 CTTCCTCAAAACATGGTGCCTGG - Intergenic
1016434326 6:144020109-144020131 CTTCCTCACAGAGTGGAGAGAGG - Intronic
1017447564 6:154521469-154521491 TGTCCTCACAACATGGAGGTTGG - Intergenic
1019186317 6:170222670-170222692 CTTCCCCACAAAATGGCAACAGG - Intergenic
1019347227 7:537137-537159 TGTCCTCACAACATGGCGGCTGG + Intergenic
1019426369 7:979021-979043 CTTCCCCACAGCATGGCGGCTGG + Intergenic
1019493632 7:1326268-1326290 CCTCCTCACAGCATAGAGGCCGG + Intergenic
1019501274 7:1366055-1366077 CTTCCTCACAACATGGTGGCAGG + Intergenic
1019556644 7:1634792-1634814 CTTCCTCACATCATGGCAGCTGG + Intergenic
1019804596 7:3114027-3114049 CATCCTCACAACATGGTGGCTGG - Intergenic
1019816187 7:3202449-3202471 CTTCCTCAAGACAAGGAGAGTGG - Intergenic
1019826659 7:3290110-3290132 CTTCCCCACAACATGGCAGCTGG - Intergenic
1020420981 7:8005057-8005079 CTTCCTCACTAAATGAAGAATGG - Intronic
1021476620 7:21068807-21068829 CTTCCTCACAATATGGAAGCTGG + Intergenic
1022368616 7:29749734-29749756 CCTCCTCACAACATGACAACTGG - Intergenic
1023173180 7:37409662-37409684 CTTCTTCACAGCATGGTGGCTGG + Intronic
1024230769 7:47361514-47361536 CAGCCTCACAAAGTGGAGACAGG - Intronic
1025220263 7:57102000-57102022 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1025603790 7:63024298-63024320 ATTCCTCACAGCCTGGAGGCTGG - Intergenic
1025631042 7:63273582-63273604 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1025651419 7:63473011-63473033 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1025826091 7:65011647-65011669 CTTTCTCACAAAATGGTGAATGG - Intergenic
1025828614 7:65031252-65031274 CTTCCTCACAGCATGGTAGCTGG + Intergenic
1025913648 7:65848114-65848136 CTTTCTCACAAAATGGTGAATGG - Intergenic
1025916143 7:65867664-65867686 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1025975974 7:66370247-66370269 CTTTCTCACAAAATGGTGAATGG + Intronic
1026178442 7:68018016-68018038 CTTCCTCCAAACATGGTGGCTGG + Intergenic
1026180021 7:68030737-68030759 CTTCCCCACAACATGGCGACTGG + Intergenic
1026490803 7:70861701-70861723 CTTCCTCACATCATGGCAGCTGG - Intergenic
1026490972 7:70863107-70863129 CTTCCTCACATCATGGCAGCTGG + Intergenic
1026980213 7:74522049-74522071 CATCCTCACAACATGGCCACTGG + Intronic
1027234087 7:76287490-76287512 CTTCCTCCCAGCCTGGAGGCCGG + Intergenic
1027404508 7:77846016-77846038 TATTCTCACAACATGGAGAAAGG - Intronic
1028210516 7:88068827-88068849 CTTCCTGACAGCATGGTGGCTGG + Intronic
1028751173 7:94384626-94384648 CTTCCTTACACCCTGGAGGCTGG - Intergenic
1029350776 7:100011372-100011394 CTTCCTCACAGGATGGTGGCTGG - Intergenic
1029381196 7:100215937-100215959 CTTGCTCACAGAATGGTGACCGG - Intronic
1029400577 7:100342888-100342910 CTTGCTCACAGAATGGTGACCGG - Intronic
1029812942 7:103067559-103067581 CTTCCTCACAGCGTGGAGGCTGG - Intronic
1029985763 7:104921910-104921932 CTTCCTCACAACATGGCAGCTGG + Intergenic
1029985920 7:104923234-104923256 TGTCCTCACAACATGGCGACTGG - Intergenic
1030532608 7:110729484-110729506 CTCCCTCAACACATGGAGATTGG + Intronic
1032442339 7:131951576-131951598 CTTCCTCACAACATGGTGGCTGG - Intergenic
1032706857 7:134427536-134427558 CTTCCTCAGAACATGGTGGCTGG - Intergenic
1034214661 7:149396042-149396064 CATCCTCACAGCATGGAGGTTGG - Intergenic
1035458033 7:159022340-159022362 CATCCTCACAGCATGGCGACTGG + Intergenic
1036222245 8:6930541-6930563 CTTCCTCAAAACACGGTGTCTGG - Intergenic
1036660972 8:10708403-10708425 CTTCCTCACAACATGGCAGTTGG + Intronic
1037946783 8:22994546-22994568 GTTCCTCACAACCAGGAGCCTGG + Exonic
1037947079 8:22996307-22996329 CTTCCTGGCAGCATGGAGGCAGG - Intronic
1038042155 8:23732642-23732664 CTTCTTCACAGCTTGGTGACTGG + Intergenic
1038857841 8:31352365-31352387 CTTCCTCATGGCATGGAGACTGG + Intergenic
1039213207 8:35238440-35238462 CTTCCTTACAATATGCCGACAGG - Intronic
1039877995 8:41603761-41603783 CTTCCTTACAACATGGTAGCTGG - Intronic
1040550455 8:48433309-48433331 CATGCACAAAACATGGAGACTGG + Intergenic
1042307154 8:67343758-67343780 TTTCCTCCCAACATGGCGGCCGG - Intergenic
1042857238 8:73279801-73279823 CTTCCTCACAAAATGGTGGCTGG - Intergenic
1043549725 8:81356932-81356954 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1044621049 8:94191011-94191033 CTTCCTCCCACCACAGAGACCGG + Intronic
1044997646 8:97852325-97852347 CTGCCTAACAACATGGAAAAGGG + Exonic
1045081000 8:98625749-98625771 CTTCCTCACAACTTTAAAACAGG - Intronic
1045193997 8:99911650-99911672 CTGCCTCACAACATGGTGGAAGG + Intergenic
1045320166 8:101076450-101076472 CTTCCTCACAACATGGCAGCTGG - Intergenic
1045487312 8:102641736-102641758 CATCCTCACAACATGACAACTGG + Intergenic
1045724501 8:105156417-105156439 CTTCCTCACACTATGGTGGCTGG + Intronic
1046802289 8:118441864-118441886 CTTCCTCACAACATGGTGGTTGG - Intronic
1048473004 8:134720065-134720087 CTTCCTTACAGCATGGATGCTGG - Intergenic
1048649826 8:136463322-136463344 ATTCCTCACAATATGGAGGCTGG + Intergenic
1048895415 8:138988136-138988158 CTTCCTCACAGCCTGGTGGCTGG - Intergenic
1048973169 8:139656477-139656499 CTCCCTCACAATCTGCAGACAGG + Intronic
1049546774 8:143235736-143235758 TTTCCTCACAACATGGCGGCCGG + Intergenic
1049566854 8:143344745-143344767 CTTACGGACAACATGGAGCCTGG - Intronic
1049586203 8:143433496-143433518 CTTCCTCACAGCATGGCTGCTGG + Intergenic
1050036403 9:1440373-1440395 CTCCATCACAACATGGGGGCTGG - Intergenic
1050848294 9:10252335-10252357 ATTACTCACAGCATGGTGACTGG - Intronic
1051054526 9:12968315-12968337 CTTCCTCACAGCATGAAGGATGG + Intergenic
1051188216 9:14482455-14482477 CTTCCTAAGAACATGGTGAGGGG - Intergenic
1051741379 9:20255638-20255660 TTTCCTCACAGTATGGAGAGTGG + Intergenic
1052482557 9:29050000-29050022 CATCATCACATCATGGAGAAAGG - Intergenic
1053351555 9:37416765-37416787 CTTCCTCACAGCCTGGAACCTGG - Intergenic
1053352367 9:37422317-37422339 CTTCCTCACAGCCTGGAACCTGG + Intergenic
1053490263 9:38494902-38494924 CTTCCCCACAACATCTAGACTGG + Intergenic
1054847209 9:69810020-69810042 CTACCTCTCAAAATGGACACAGG + Intergenic
1055102915 9:72483449-72483471 CTTCCTCACATCATGGTGTCTGG + Intergenic
1056690303 9:88802704-88802726 CTTCCCCACAGCATGGTGACTGG - Intergenic
1056785358 9:89588843-89588865 CTTCCTCAGAACATGGCGACTGG + Intergenic
1056809192 9:89751077-89751099 CTTTCTCACAGCATGGTGGCTGG + Intergenic
1056947570 9:91012980-91013002 CTTCCTCACAATATGGCAGCTGG - Intergenic
1057190718 9:93085856-93085878 CTTCCTCACAACATGGCAGCCGG + Intergenic
1057670597 9:97084170-97084192 CTTCCCCACAACATCTAGGCTGG + Intergenic
1058143222 9:101380512-101380534 CTTACTCACAGCATGGTGGCTGG + Intronic
1058183181 9:101822569-101822591 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1059356136 9:113700989-113701011 CTTCCTCACAGCATGGTCTCTGG - Intergenic
1060142128 9:121219421-121219443 CTTCCTGATAGCATTGAGACAGG + Intronic
1060490525 9:124080830-124080852 CTTCCTCACAGCATGGTGGCGGG + Intergenic
1060496426 9:124122661-124122683 CTTCCTCACAGCATGGTATCTGG - Intergenic
1060758922 9:126232685-126232707 CCTCCTCACAGCATGGCCACTGG + Intergenic
1061346227 9:130027833-130027855 CTTCCTAACAATATGGTGACTGG + Intronic
1062028839 9:134352887-134352909 CTTCCTCACACCAAGGAAGCAGG - Intronic
1062054058 9:134461781-134461803 CATCCTCTCAACATGGAGGCTGG + Intergenic
1062188179 9:135229651-135229673 CTTAACCTCAACATGGAGACAGG - Intergenic
1186415307 X:9378392-9378414 CATCCTCACAACATGCTGTCTGG + Intergenic
1186543300 X:10422843-10422865 CTTCCTCACAGCATGGTGTCTGG + Intergenic
1186567693 X:10681519-10681541 CTCCCTCACAACATGCTGTCTGG + Intronic
1186693755 X:12007163-12007185 CTCCCTCACAGCATGGAGATTGG - Intergenic
1186768477 X:12794339-12794361 CTTCCTTACAGCATGGAAGCTGG + Intronic
1186833221 X:13411833-13411855 CTTCCTGAAAATTTGGAGACTGG - Intergenic
1186950625 X:14620638-14620660 CTTTATCACAAAATGGGGACTGG + Intronic
1187077671 X:15951853-15951875 CTTCTTCACAGCATGGTGGCTGG - Intergenic
1187340483 X:18416845-18416867 CTTCCTCACAACACAGCGACTGG + Intergenic
1187572813 X:20521898-20521920 TTTCCTCACAGCATGGTGGCTGG + Intergenic
1188297553 X:28468557-28468579 CTCCCTCACAGCATGGAGTATGG + Intergenic
1189230618 X:39449958-39449980 CTTCCTCACAGCAAGGCAACTGG + Intergenic
1189257082 X:39648670-39648692 CTTCCTCACAGCGTGGAGACTGG - Intergenic
1189269498 X:39740888-39740910 CTTCCTCACAGCATGGCAGCAGG + Intergenic
1189345751 X:40240065-40240087 CTTCCTCATAGCATGGAGGCTGG + Intergenic
1189370934 X:40428644-40428666 CTTCCTCACAGCATGGTTGCTGG - Intergenic
1189371001 X:40429211-40429233 CTGCCTCACAATATGGCAACTGG - Intergenic
1189928405 X:45982119-45982141 CTTCCTCATAGCATGGTGGCTGG - Intergenic
1190782551 X:53612044-53612066 CTTTCTCACAATATGGTGAAAGG - Intronic
1192185911 X:68946755-68946777 CTTTCTCCCAACATGGAGGCAGG - Intergenic
1194197864 X:90917736-90917758 CTTCCTCACCACATGGTGAGTGG - Intergenic
1198668228 X:139048163-139048185 CTTCTTCACAACATGTACAAAGG - Intronic
1198678607 X:139157542-139157564 CTGCATCACAACATGGTGAAGGG - Intronic
1200384372 X:155874912-155874934 CCTCCTCCCAAGATGGGGACAGG - Intergenic
1200543874 Y:4495083-4495105 CTTCCTCACCACATGGTGAGTGG + Intergenic