ID: 923236740

View in Genome Browser
Species Human (GRCh38)
Location 1:232040857-232040879
Sequence CAGGCTGTGAGTGGTTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923236740_923236745 16 Left 923236740 1:232040857-232040879 CCAGGAAAACCACTCACAGCCTG 0: 1
1: 0
2: 2
3: 20
4: 182
Right 923236745 1:232040896-232040918 CTTGAAGATCCTCATCCAATTGG 0: 1
1: 0
2: 1
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923236740 Original CRISPR CAGGCTGTGAGTGGTTTTCC TGG (reversed) Intronic
900528260 1:3139799-3139821 CAGGCTGAGAGTGGTTTGGTGGG + Intronic
902681219 1:18045209-18045231 CAGACTGGGAGCGGTTTTTCAGG - Intergenic
903669886 1:25029061-25029083 AGGGCGGTGAGAGGTTTTCCAGG + Intergenic
904594783 1:31636736-31636758 CAGCCTGTGTGTGACTTTCCTGG - Intronic
906276281 1:44518527-44518549 CAGGCAGTGCATGGTATTCCTGG + Intronic
906662165 1:47590687-47590709 CATGCTGGGAGTGGGTTTTCAGG + Intergenic
906744933 1:48214996-48215018 CTGGCTGAGAGTGGTTTTTCAGG + Intergenic
907298566 1:53470951-53470973 CAGGGCATGTGTGGTTTTCCGGG + Intergenic
908805054 1:67921865-67921887 CAGCCTGTGAGGTGGTTTCCAGG + Intergenic
910340201 1:86178280-86178302 CAGGCTGTTTCTGGTTGTCCTGG - Intergenic
911524483 1:98967303-98967325 GAGGATGTGAGTGGCCTTCCTGG - Intronic
912469420 1:109896224-109896246 CTGGCTGTGAGAGGGTTTCCAGG - Intergenic
913220743 1:116658472-116658494 AAAGCTGTGAGTGGATATCCTGG - Intronic
915125606 1:153661467-153661489 CTGGCTGTGTGTAGGTTTCCTGG - Exonic
915546368 1:156600931-156600953 TAGGCTGTGTGTGGTCTTACAGG - Intronic
916002406 1:160629634-160629656 CAGGTTGTAAGTGATTTTTCTGG - Intronic
916031468 1:160881118-160881140 CTGGCTGGGACTGGTTTTCATGG - Intronic
917259225 1:173148835-173148857 CAGTCTGGGAGTGCTGTTCCAGG + Intergenic
919642582 1:200059907-200059929 TTGGCTGTGGGTGGTTTTCTTGG - Intronic
920952733 1:210587566-210587588 CATTCTGTGATTGGATTTCCAGG + Intronic
921182640 1:212643878-212643900 CAGGCTGTGGGTCTTTGTCCTGG + Intergenic
921265244 1:213416464-213416486 CAGGCTGTGAGTAGTGTGGCTGG + Intergenic
923236740 1:232040857-232040879 CAGGCTGTGAGTGGTTTTCCTGG - Intronic
923857763 1:237863434-237863456 CAGCCTGTGATTGGCTGTCCTGG - Intergenic
1063610625 10:7558892-7558914 CCGGTTCTGAGTGGTTTTACTGG - Intergenic
1063703310 10:8406863-8406885 CAGTAGGTGAGTGGGTTTCCTGG - Intergenic
1064410389 10:15099155-15099177 GAGGGTGGGAGTGGTATTCCAGG + Intronic
1065281525 10:24143704-24143726 CAGGGTGTGATTGGTTTTACTGG + Intronic
1065750332 10:28880024-28880046 GAGGCTGGGAGAGGGTTTCCAGG + Intronic
1068630167 10:59289899-59289921 CAGACTGCTAGTGCTTTTCCTGG + Intronic
1068707654 10:60094473-60094495 GAGGCTGGGCGTGGTTTTCACGG - Intronic
1069198090 10:65579847-65579869 TAGCCTGTAACTGGTTTTCCTGG - Intergenic
1069825358 10:71251842-71251864 CAGCCTGTGGGTTTTTTTCCTGG - Intronic
1071477964 10:86041234-86041256 CAGGGTGTGAGTGGTTGGGCAGG + Intronic
1071994928 10:91138032-91138054 CCAGCTGTGGGTGGTTTACCTGG - Intergenic
1072751735 10:97985698-97985720 TAGGCTGTGGCTGGTTTTCTTGG - Intronic
1073256793 10:102157361-102157383 CAGGCTGTAAATTCTTTTCCTGG - Intronic
1075344195 10:121670345-121670367 GAGGGTGTGGGTGGGTTTCCAGG + Intergenic
1075578686 10:123599563-123599585 CAGCTTGTGAGTGCTCTTCCAGG - Intergenic
1075898217 10:126016757-126016779 CAGGCTGTGTTTGGCTTTCAGGG - Exonic
1077104174 11:834823-834845 CAGACTGGGAGGGTTTTTCCTGG - Intronic
1077469645 11:2751147-2751169 AAGGCAGTGACTGGTTTTGCCGG + Intronic
1078067115 11:8085822-8085844 TTGGCTGTGTGTGCTTTTCCAGG + Intronic
1078533150 11:12152484-12152506 CAGGGTCTGAGTGTTCTTCCTGG + Intronic
1079241341 11:18724216-18724238 CCGGCTGTGAATGGTTGTCATGG + Exonic
1082759165 11:57109793-57109815 CTGGCTGTGCCAGGTTTTCCTGG + Intergenic
1083149409 11:60782548-60782570 CATGGGGTGAGTGTTTTTCCAGG - Intergenic
1084671417 11:70608718-70608740 TCGGCTGTGAATGGGTTTCCGGG - Intronic
1084902661 11:72321480-72321502 CTGGCTGTGAGTGCATTTACAGG + Intronic
1087717322 11:101623478-101623500 CAGGCTCTGAGTAGATTTCCGGG - Intronic
1090862567 11:130666894-130666916 CAGCCTGTGTGTGGCTTTTCTGG + Intergenic
1091080467 11:132662267-132662289 AAGGCAGTGAGTGGTTCTCCAGG - Intronic
1091703489 12:2679097-2679119 AAGGCTGGGAGTGAGTTTCCAGG - Intronic
1092256488 12:6928737-6928759 GATGCTGTGAGTGGGGTTCCGGG + Intronic
1092737105 12:11592933-11592955 CAGGATGGGAGTGGTGTTCATGG + Intergenic
1094309832 12:29067656-29067678 AAGACTGTGAGTATTTTTCCAGG + Intergenic
1094482722 12:30897593-30897615 CAGGCTGTGTGAGGTCTTGCAGG - Intergenic
1095529681 12:43171993-43172015 CAAGATATCAGTGGTTTTCCTGG - Intergenic
1095984975 12:47993483-47993505 CAGGGTGAGAGTGGTTCCCCGGG - Exonic
1098736356 12:74110845-74110867 CAGGTTGTGGGTTTTTTTCCTGG + Intergenic
1099617860 12:84961638-84961660 CTGGTTTTTAGTGGTTTTCCTGG + Intergenic
1102330244 12:112022654-112022676 AAGGCTGTCTGTGATTTTCCAGG + Exonic
1103266639 12:119636147-119636169 CAGGTTGGGAGTGGGTTGCCAGG - Intronic
1103556760 12:121771137-121771159 CAGCCCGTGAGGGGTTCTCCAGG + Intronic
1104991121 12:132624401-132624423 CACGCAGTGAATGCTTTTCCAGG - Exonic
1110227462 13:73134829-73134851 CAGATTATGAGTTGTTTTCCTGG + Intergenic
1113036386 13:106053839-106053861 TAGGCTGGGAGTTGTTTTTCTGG - Intergenic
1114567485 14:23643400-23643422 CAGGATGAGAGTAGTATTCCAGG + Intronic
1122144984 14:99683841-99683863 CAGGCTGGGATGGGGTTTCCGGG + Intergenic
1130354003 15:83113677-83113699 CAGGCTGTGGGTTGATTTCAGGG + Intronic
1131210710 15:90493377-90493399 CAGGCTCTGATTTTTTTTCCTGG + Intronic
1132309924 15:100849907-100849929 CAGGCTGCGGGTGGGTTACCTGG - Intergenic
1132623132 16:877638-877660 CCGGCTGTGGGTTGTTTTCGTGG - Intronic
1134131910 16:11655854-11655876 CTGCCTGTGAGGGGTTTTCCAGG + Intergenic
1134373933 16:13652263-13652285 CAGGCTGAGTGGTGTTTTCCAGG + Intergenic
1136555121 16:31003092-31003114 CAGGCTGTGCTGGCTTTTCCTGG - Intronic
1136989672 16:35144384-35144406 CCGGTTGTCAGTAGTTTTCCTGG + Intergenic
1137798501 16:51241551-51241573 CAGGCTGTTAGTGGTATTTGGGG + Intergenic
1137984288 16:53094540-53094562 CAGGGTGTGTGTGTGTTTCCAGG - Intronic
1138475891 16:57270450-57270472 CATGCTGGGCGTGGTTTTCCTGG - Intronic
1141134570 16:81457180-81457202 CCGCCAGTCAGTGGTTTTCCAGG + Intronic
1141140997 16:81496901-81496923 CAGGCTGTGGGTGGGTGTCCCGG - Intronic
1143569229 17:7744392-7744414 GAGACTGTGAGTGTTTGTCCTGG + Intronic
1147320410 17:39642535-39642557 CAGGCTCAGAGTGGGTTTCCAGG - Intronic
1151383306 17:73740234-73740256 CAGGCTGGGAGATGTTTGCCTGG + Intergenic
1160038364 18:75321694-75321716 CAGGCTGTGTGTGGGTGTCAAGG + Intergenic
1160171401 18:76558397-76558419 CAGGATGTCAGGTGTTTTCCTGG - Intergenic
1161324899 19:3658896-3658918 GAGGCTGTGGGGGGTTGTCCTGG - Intronic
1161355419 19:3816713-3816735 CAGGCTGTGCGTGGGCTTCTCGG + Exonic
1162475246 19:10895834-10895856 CAGGCAGTGAGGGCTTGTCCGGG + Intronic
1164476556 19:28579941-28579963 CAGGCTCTCAGTGGTTCTCAGGG - Intergenic
1165060684 19:33203904-33203926 CAGGCAGTGAGCGGTGGTCCTGG + Intronic
1165755500 19:38290515-38290537 CAGGCTGTGTGTTCTCTTCCAGG + Exonic
925997319 2:9304039-9304061 CAGGCTGCCAGTGGCTGTCCCGG - Intronic
926062584 2:9813571-9813593 AAGGCTGCCAGTGGTTCTCCTGG + Intergenic
926320573 2:11746278-11746300 CAGGCCCTGGGTGGTTTACCTGG + Intronic
926894087 2:17665324-17665346 CAGGTTGTAGTTGGTTTTCCAGG + Exonic
927460623 2:23295430-23295452 CCTGTTGTGAGTGGTGTTCCAGG + Intergenic
928616781 2:33048192-33048214 CAGGCAGTGACTGGTCTTCATGG + Intronic
930221284 2:48749191-48749213 GCAGCTGTGAGTGGTTTGCCAGG + Intronic
931635570 2:64338225-64338247 CAGGGTGGGATTGTTTTTCCAGG + Intergenic
931872067 2:66472136-66472158 CAGGCTGTGTGTGGTGGCCCTGG - Intronic
931931901 2:67147175-67147197 CAGGGTGTGTGGGGTTATCCTGG - Intergenic
933810757 2:86031438-86031460 CTGGCTGTGGGTGGGTTTCCGGG + Exonic
935783050 2:106524724-106524746 CAGGCTCTGAGTGGAATTTCCGG + Intergenic
935938885 2:108217950-108217972 GAGGCTGAGAATGGTCTTCCTGG - Intergenic
939756816 2:146123921-146123943 CAGGCTGGCAGTGGATTTTCAGG - Intergenic
939827019 2:147027067-147027089 CAGTAAGTGAGTGGTTTTCCTGG + Intergenic
940459131 2:153940218-153940240 TAGGCTGTGAGTGGATTTCCTGG + Intronic
944430759 2:199630791-199630813 TTGCCTGTGAGTGGTTCTCCAGG + Intergenic
945406878 2:209459493-209459515 CAGACTTAGAGTTGTTTTCCTGG - Intronic
946016960 2:216611658-216611680 CAGGCTGGGAAGGGCTTTCCAGG - Intergenic
946130382 2:217601990-217602012 GAGGCTCTGTGTGTTTTTCCAGG - Intronic
947093780 2:226543392-226543414 CAGTCTGTGAATGTATTTCCAGG - Intergenic
948126021 2:235565128-235565150 CTGGCTGTGAGTGCTGGTCCAGG - Intronic
948693943 2:239723319-239723341 CAGGCTGTGCGTGCTTCTCTGGG - Intergenic
1168815929 20:737024-737046 CTGCATGTGGGTGGTTTTCCAGG + Intergenic
1170884058 20:20322932-20322954 TAGACTGTGAGTGGTTTCCAGGG + Intronic
1170940459 20:20844352-20844374 CAGGCTCTGAGGGGTTATCAGGG - Intergenic
1175770357 20:61619613-61619635 CAGGCTGTGTGAGGCTCTCCTGG + Intronic
1176406781 21:6373424-6373446 CATGCTTTGAGTGGTCTTCTGGG - Intergenic
1176667051 21:9697306-9697328 CAGGCTGAGAATGGTTTTTATGG + Intergenic
1179048559 21:37869104-37869126 CAGGCTGTGAGTGGATCGCCTGG + Intronic
1181190698 22:21137346-21137368 AAAGCTGTGAGTGGATATCCTGG + Intergenic
1181208507 22:21273161-21273183 AAAGCTGTGAGTGGATATCCTGG - Intergenic
1182002142 22:26928208-26928230 CAGGCTTTGAATTGATTTCCTGG + Intergenic
1182338795 22:29603227-29603249 CAGCCTCTAAGTGGTTTCCCGGG + Intergenic
1182774349 22:32819859-32819881 CAGGCAGTGAGTGGGCTCCCAGG - Intronic
1183367339 22:37413957-37413979 CAGGCTGTGAGTGGCACGCCGGG - Intronic
1203272408 22_KI270734v1_random:64585-64607 AAAGCTGTGAGTGGATATCCTGG - Intergenic
949524692 3:4891587-4891609 CAGGCTATGACTGCTTTGCCAGG + Intergenic
951635816 3:24774903-24774925 CAGCCTTTGGGTGATTTTCCTGG + Intergenic
953683584 3:45058844-45058866 CTGGCTGTGAGGGTGTTTCCAGG - Intergenic
961075619 3:123979309-123979331 GAGGTTGTGAGTGGGTGTCCTGG - Intronic
961308066 3:125973199-125973221 GAGGTTGTGAGTGGGTGTCCTGG + Intronic
962756621 3:138469862-138469884 AAGGCAGGGAGTGGTTTGCCAGG - Intronic
967653447 3:192015525-192015547 AAGGCTGTGAGAGTTTTTACTGG + Intergenic
968974474 4:3814038-3814060 CAGGTTGTGAGTGGTTTGAGAGG - Intergenic
969311522 4:6355589-6355611 CAGGGTGTGAGGGGTTTTTTAGG + Intronic
969998275 4:11337531-11337553 CAGTCAGTGGGTGGTTTTCTGGG + Intergenic
971466576 4:26969770-26969792 GATTCTGTGAGTGGTTTTCAAGG + Intronic
972926275 4:44013141-44013163 CAGGCTGTATGTGGTTGTCTGGG - Intergenic
976611795 4:87038080-87038102 CACGATGTCAGTTGTTTTCCTGG - Intronic
985407962 4:189655031-189655053 CAGGCTGAGAATGGTTTTTATGG - Intergenic
985590499 5:762026-762048 AGGGCTGTGAGTGGCTCTCCAGG - Intronic
986598761 5:9450163-9450185 GAGGCTGAGAGTGGTTCTCAAGG - Intronic
987418569 5:17691439-17691461 CAAGCTGTGAGTGGGTTTCAAGG + Intergenic
988269071 5:28991317-28991339 TAGGGTGGGAGTGATTTTCCAGG - Intergenic
997432385 5:133849328-133849350 CAGGCTGTGTGTGGCTTCCATGG + Intergenic
999366369 5:151026338-151026360 GTGGCTGTGAGTGCTTTTTCTGG + Intronic
1001574066 5:172750353-172750375 GAGGCTGTGGGTGATTGTCCAGG - Intergenic
1003343605 6:5244914-5244936 CAGGCTGAGGGCTGTTTTCCTGG + Intronic
1005488364 6:26322686-26322708 CAGGCTGTAAGTTTTTTTCAGGG + Intergenic
1007175959 6:39897641-39897663 CAGGCTCTGAGTGGTCCTCTGGG + Intronic
1009851623 6:69206841-69206863 CAGGTTGTGATTATTTTTCCTGG + Intronic
1010236719 6:73580798-73580820 CCTGCTGTGAGTGGTTTTTAGGG + Intergenic
1012358559 6:98347719-98347741 GAGGCTGTGAGTGCCTATCCTGG + Intergenic
1012759564 6:103281623-103281645 CAGGCTGGGAGTGGTAATACTGG - Intergenic
1013031701 6:106339957-106339979 CAGGCATTCAGTGGTTTTACCGG + Intergenic
1014151649 6:118063718-118063740 CAGGCTGTGATTCCTTCTCCTGG - Intronic
1014904752 6:127012374-127012396 GAGGCTGTGAGATGTATTCCTGG - Intergenic
1016129332 6:140446481-140446503 CAGGCTGTGTGTGATTGTCCTGG + Intergenic
1016833219 6:148453188-148453210 CAGGCTGTGTGTGTTCTTGCTGG + Intronic
1017512548 6:155127170-155127192 GAGACTGAGAGTTGTTTTCCTGG + Intronic
1017727998 6:157288861-157288883 CAGGCTCAGAGTGGCCTTCCAGG - Intergenic
1018813481 6:167314465-167314487 CAGGCTGTGGAGGGTTTTCCTGG + Intronic
1021376024 7:19907429-19907451 CAGTCTGTGTGTGTTTTTACAGG - Intergenic
1021397325 7:20166425-20166447 CATGCTGTGAGTGGCCTTACTGG + Intronic
1025295550 7:57773071-57773093 CCGGCTGTCAGTCGTTTTCCTGG + Intergenic
1028101144 7:86822457-86822479 AAGGATGTGAGTGATTTTACAGG + Intronic
1031861405 7:126983815-126983837 CAGGCCGTGGGTTTTTTTCCTGG - Intronic
1031982204 7:128135528-128135550 CAGGCTGTGAGAGGTTTCCCTGG + Intergenic
1034317167 7:150143556-150143578 CAGGGTGTGAGGGGTTGTCTGGG - Intergenic
1034775586 7:153823660-153823682 CAGGGTGTGAGGGGTTGTCTGGG + Intergenic
1035135387 7:156698261-156698283 CAGGCTGGTATTGGTTTTCCAGG + Intronic
1036120148 8:6007864-6007886 CAAGGTGTGAGTTATTTTCCTGG + Intergenic
1038048821 8:23790186-23790208 AAGGCTTTGAGTGGCTTGCCGGG - Intergenic
1038939626 8:32290010-32290032 CTGGCTTTGAGTGATTCTCCTGG - Intronic
1039572580 8:38599543-38599565 CAGCCTGTGTGTGGTTATCTTGG - Intergenic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1045248240 8:100461720-100461742 CAGGCTGAGAGTGGTCTTGAGGG - Intergenic
1046355694 8:113082014-113082036 CAGGGTGGGAGTGATTGTCCAGG - Intronic
1047308147 8:123669843-123669865 CAGCCTGTGAGTGGAGTCCCTGG + Intergenic
1047718955 8:127620869-127620891 CAGGCTGTGGGTGGATTCCAGGG - Intergenic
1047788993 8:128183124-128183146 CAGGCTGTTAGATGTTTTCCAGG + Intergenic
1048599634 8:135906136-135906158 CAGGCTTTGGGTGGTTTCCCAGG + Intergenic
1049385681 8:142341865-142341887 CAGGGTTCGAGTGGGTTTCCTGG - Intronic
1052207813 9:25864857-25864879 CAGTCTTTGAGTGGATTTCAAGG - Intergenic
1053268377 9:36732653-36732675 CAAGCTGTGGGTGGTCTTCCAGG + Intergenic
1055672213 9:78618920-78618942 CAGGGTTTGAGTGGTTCTTCAGG + Intergenic
1057851241 9:98568432-98568454 CAGGCTGGACGTGGTTTTCAAGG + Intronic
1058581057 9:106457842-106457864 GAAGCTGTGAATGGTTTACCAGG + Intergenic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1062054304 9:134463033-134463055 CAGTCTGTGGGTGGGTTGCCCGG + Intergenic
1062403251 9:136381640-136381662 CTGGCTGTGACTGGGTGTCCTGG + Intronic
1062520568 9:136956039-136956061 CAGGCTGGGAGTGGGTGTCTGGG - Intronic
1203659045 Un_KI270753v1:24456-24478 CAGGCTGAGAATGGTTTTTATGG - Intergenic
1187432112 X:19234568-19234590 CAGGCTTTGAGCCGTTTTCTTGG + Intergenic
1190414462 X:50167337-50167359 CAAGCTGTCAGTGGTATTACGGG - Intergenic
1192205761 X:69095074-69095096 CAGCCTGTCAGTGGCTTACCTGG - Intergenic
1193708350 X:84850720-84850742 GAGGCTGTGATTTGTCTTCCTGG - Intergenic
1194001695 X:88437690-88437712 AAGGCAGTGAGGTGTTTTCCTGG - Intergenic
1196212246 X:113009142-113009164 CTGGCTGTGACTGGTTTTGACGG + Intergenic
1197007052 X:121514431-121514453 CAGGAAGTGAATGGTTTTCAAGG + Intergenic
1198934301 X:141889768-141889790 CAGGCTGTGGATTTTTTTCCTGG - Intronic