ID: 923239737

View in Genome Browser
Species Human (GRCh38)
Location 1:232071582-232071604
Sequence CTGGTCCTGGACTGTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923239733_923239737 14 Left 923239733 1:232071545-232071567 CCTTTGAATGTCTGATAGAATTC No data
Right 923239737 1:232071582-232071604 CTGGTCCTGGACTGTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923239737 Original CRISPR CTGGTCCTGGACTGTTTTGT TGG Intergenic
No off target data available for this crispr