ID: 923243212

View in Genome Browser
Species Human (GRCh38)
Location 1:232105976-232105998
Sequence CACTCTTGCTGTGCTGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923243212_923243220 29 Left 923243212 1:232105976-232105998 CCTGAGACAGCACAGCAAGAGTG No data
Right 923243220 1:232106028-232106050 AGGGGGCCCACGGAAGACTTTGG No data
923243212_923243219 19 Left 923243212 1:232105976-232105998 CCTGAGACAGCACAGCAAGAGTG No data
Right 923243219 1:232106018-232106040 CACTATTGATAGGGGGCCCACGG No data
923243212_923243216 10 Left 923243212 1:232105976-232105998 CCTGAGACAGCACAGCAAGAGTG No data
Right 923243216 1:232106009-232106031 TTATTTGCTCACTATTGATAGGG No data
923243212_923243218 12 Left 923243212 1:232105976-232105998 CCTGAGACAGCACAGCAAGAGTG No data
Right 923243218 1:232106011-232106033 ATTTGCTCACTATTGATAGGGGG No data
923243212_923243215 9 Left 923243212 1:232105976-232105998 CCTGAGACAGCACAGCAAGAGTG No data
Right 923243215 1:232106008-232106030 ATTATTTGCTCACTATTGATAGG No data
923243212_923243217 11 Left 923243212 1:232105976-232105998 CCTGAGACAGCACAGCAAGAGTG No data
Right 923243217 1:232106010-232106032 TATTTGCTCACTATTGATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923243212 Original CRISPR CACTCTTGCTGTGCTGTCTC AGG (reversed) Intergenic
No off target data available for this crispr