ID: 923243219

View in Genome Browser
Species Human (GRCh38)
Location 1:232106018-232106040
Sequence CACTATTGATAGGGGGCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923243212_923243219 19 Left 923243212 1:232105976-232105998 CCTGAGACAGCACAGCAAGAGTG No data
Right 923243219 1:232106018-232106040 CACTATTGATAGGGGGCCCACGG No data
923243211_923243219 20 Left 923243211 1:232105975-232105997 CCCTGAGACAGCACAGCAAGAGT No data
Right 923243219 1:232106018-232106040 CACTATTGATAGGGGGCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923243219 Original CRISPR CACTATTGATAGGGGGCCCA CGG Intergenic
No off target data available for this crispr