ID: 923249962

View in Genome Browser
Species Human (GRCh38)
Location 1:232170768-232170790
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923249962_923249965 7 Left 923249962 1:232170768-232170790 CCCACTTTGGCCAGATGGCTCTC No data
Right 923249965 1:232170798-232170820 GTTCTTCCTTCTCCCCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923249962 Original CRISPR GAGAGCCATCTGGCCAAAGT GGG (reversed) Intergenic
No off target data available for this crispr