ID: 923253570

View in Genome Browser
Species Human (GRCh38)
Location 1:232199439-232199461
Sequence AGTTATCTGCAGAAGATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923253567_923253570 15 Left 923253567 1:232199401-232199423 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG No data
923253566_923253570 16 Left 923253566 1:232199400-232199422 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG No data
923253569_923253570 4 Left 923253569 1:232199412-232199434 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG No data
923253565_923253570 22 Left 923253565 1:232199394-232199416 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG No data
923253564_923253570 25 Left 923253564 1:232199391-232199413 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923253570 Original CRISPR AGTTATCTGCAGAAGATAGC AGG Intergenic
No off target data available for this crispr