ID: 923254621

View in Genome Browser
Species Human (GRCh38)
Location 1:232210976-232210998
Sequence GAGGAGAAGCACAGTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923254619_923254621 -9 Left 923254619 1:232210962-232210984 CCTGGGGAGGTTAGGAGGAGAAG No data
Right 923254621 1:232210976-232210998 GAGGAGAAGCACAGTGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923254621 Original CRISPR GAGGAGAAGCACAGTGTGGT TGG Intergenic
No off target data available for this crispr