ID: 923260240

View in Genome Browser
Species Human (GRCh38)
Location 1:232261385-232261407
Sequence CTGGTGCTTTTGAGGAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923260240_923260250 -3 Left 923260240 1:232261385-232261407 CCAGTTTTCCTCAAAAGCACCAG No data
Right 923260250 1:232261405-232261427 CAGGGAGGATCAAGGGTCTGGGG No data
923260240_923260249 -4 Left 923260240 1:232261385-232261407 CCAGTTTTCCTCAAAAGCACCAG No data
Right 923260249 1:232261404-232261426 CCAGGGAGGATCAAGGGTCTGGG No data
923260240_923260251 21 Left 923260240 1:232261385-232261407 CCAGTTTTCCTCAAAAGCACCAG No data
Right 923260251 1:232261429-232261451 AGACCTGCTTTAGAAGCCTCAGG No data
923260240_923260246 -10 Left 923260240 1:232261385-232261407 CCAGTTTTCCTCAAAAGCACCAG No data
Right 923260246 1:232261398-232261420 AAAGCACCAGGGAGGATCAAGGG No data
923260240_923260247 -5 Left 923260240 1:232261385-232261407 CCAGTTTTCCTCAAAAGCACCAG No data
Right 923260247 1:232261403-232261425 ACCAGGGAGGATCAAGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923260240 Original CRISPR CTGGTGCTTTTGAGGAAAAC TGG (reversed) Intergenic
No off target data available for this crispr