ID: 923261013

View in Genome Browser
Species Human (GRCh38)
Location 1:232268099-232268121
Sequence CAATGTGATCAAAGAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923261013_923261016 16 Left 923261013 1:232268099-232268121 CCTTCCTTTCTTTGATCACATTG No data
Right 923261016 1:232268138-232268160 TATGTTAAAGATTAATTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923261013 Original CRISPR CAATGTGATCAAAGAAAGGA AGG (reversed) Intergenic
No off target data available for this crispr