ID: 923261111

View in Genome Browser
Species Human (GRCh38)
Location 1:232268745-232268767
Sequence TATGATAAACATCCTGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923261111_923261115 21 Left 923261111 1:232268745-232268767 CCATGAGCAGGATGTTTATCATA No data
Right 923261115 1:232268789-232268811 TTATGTAAACCTTCTGTGAGGGG No data
923261111_923261114 20 Left 923261111 1:232268745-232268767 CCATGAGCAGGATGTTTATCATA No data
Right 923261114 1:232268788-232268810 GTTATGTAAACCTTCTGTGAGGG No data
923261111_923261113 19 Left 923261111 1:232268745-232268767 CCATGAGCAGGATGTTTATCATA No data
Right 923261113 1:232268787-232268809 TGTTATGTAAACCTTCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923261111 Original CRISPR TATGATAAACATCCTGCTCA TGG (reversed) Intergenic
No off target data available for this crispr