ID: 923263325

View in Genome Browser
Species Human (GRCh38)
Location 1:232288343-232288365
Sequence TTTCCCACCCTCGTTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923263325_923263328 -1 Left 923263325 1:232288343-232288365 CCAGCTCCAACGAGGGTGGGAAA No data
Right 923263328 1:232288365-232288387 AAGCACACAAGGAAAATGCAAGG No data
923263325_923263333 12 Left 923263325 1:232288343-232288365 CCAGCTCCAACGAGGGTGGGAAA No data
Right 923263333 1:232288378-232288400 AAATGCAAGGGGGTGCATGGAGG No data
923263325_923263330 1 Left 923263325 1:232288343-232288365 CCAGCTCCAACGAGGGTGGGAAA No data
Right 923263330 1:232288367-232288389 GCACACAAGGAAAATGCAAGGGG No data
923263325_923263329 0 Left 923263325 1:232288343-232288365 CCAGCTCCAACGAGGGTGGGAAA No data
Right 923263329 1:232288366-232288388 AGCACACAAGGAAAATGCAAGGG No data
923263325_923263334 28 Left 923263325 1:232288343-232288365 CCAGCTCCAACGAGGGTGGGAAA No data
Right 923263334 1:232288394-232288416 ATGGAGGATGCACCTCCTGCTGG No data
923263325_923263335 29 Left 923263325 1:232288343-232288365 CCAGCTCCAACGAGGGTGGGAAA No data
Right 923263335 1:232288395-232288417 TGGAGGATGCACCTCCTGCTGGG No data
923263325_923263331 2 Left 923263325 1:232288343-232288365 CCAGCTCCAACGAGGGTGGGAAA No data
Right 923263331 1:232288368-232288390 CACACAAGGAAAATGCAAGGGGG No data
923263325_923263332 9 Left 923263325 1:232288343-232288365 CCAGCTCCAACGAGGGTGGGAAA No data
Right 923263332 1:232288375-232288397 GGAAAATGCAAGGGGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923263325 Original CRISPR TTTCCCACCCTCGTTGGAGC TGG (reversed) Intergenic
No off target data available for this crispr