ID: 923270206

View in Genome Browser
Species Human (GRCh38)
Location 1:232348406-232348428
Sequence CAGCTGGGACGTCTTGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923270199_923270206 16 Left 923270199 1:232348367-232348389 CCCGTCTCTACAATAAATAAATA 0: 24
1: 253
2: 2997
3: 20361
4: 228687
Right 923270206 1:232348406-232348428 CAGCTGGGACGTCTTGGCAATGG No data
923270200_923270206 15 Left 923270200 1:232348368-232348390 CCGTCTCTACAATAAATAAATAA 0: 30
1: 203
2: 5030
3: 22355
4: 256467
Right 923270206 1:232348406-232348428 CAGCTGGGACGTCTTGGCAATGG No data
923270198_923270206 17 Left 923270198 1:232348366-232348388 CCCCGTCTCTACAATAAATAAAT 0: 3
1: 71
2: 1178
3: 12555
4: 149187
Right 923270206 1:232348406-232348428 CAGCTGGGACGTCTTGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923270206 Original CRISPR CAGCTGGGACGTCTTGGCAA TGG Intergenic
No off target data available for this crispr