ID: 923270976

View in Genome Browser
Species Human (GRCh38)
Location 1:232354725-232354747
Sequence GAGGATTCCCCTACTAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923270976_923270985 12 Left 923270976 1:232354725-232354747 CCTGTCTTAGTAGGGGAATCCTC No data
Right 923270985 1:232354760-232354782 TGCAACGGGTGTTTGGGAGTAGG No data
923270976_923270986 13 Left 923270976 1:232354725-232354747 CCTGTCTTAGTAGGGGAATCCTC No data
Right 923270986 1:232354761-232354783 GCAACGGGTGTTTGGGAGTAGGG No data
923270976_923270982 6 Left 923270976 1:232354725-232354747 CCTGTCTTAGTAGGGGAATCCTC No data
Right 923270982 1:232354754-232354776 GCACCCTGCAACGGGTGTTTGGG No data
923270976_923270978 -3 Left 923270976 1:232354725-232354747 CCTGTCTTAGTAGGGGAATCCTC No data
Right 923270978 1:232354745-232354767 CTCAGTCCAGCACCCTGCAACGG No data
923270976_923270987 25 Left 923270976 1:232354725-232354747 CCTGTCTTAGTAGGGGAATCCTC No data
Right 923270987 1:232354773-232354795 TGGGAGTAGGGAAGTGTCTTTGG No data
923270976_923270979 -2 Left 923270976 1:232354725-232354747 CCTGTCTTAGTAGGGGAATCCTC No data
Right 923270979 1:232354746-232354768 TCAGTCCAGCACCCTGCAACGGG No data
923270976_923270981 5 Left 923270976 1:232354725-232354747 CCTGTCTTAGTAGGGGAATCCTC No data
Right 923270981 1:232354753-232354775 AGCACCCTGCAACGGGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923270976 Original CRISPR GAGGATTCCCCTACTAAGAC AGG (reversed) Intergenic
No off target data available for this crispr