ID: 923271046

View in Genome Browser
Species Human (GRCh38)
Location 1:232355272-232355294
Sequence CTAGTCATGTGCTCAGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923271046_923271047 0 Left 923271046 1:232355272-232355294 CCAGACACTGAGCACATGACTAG No data
Right 923271047 1:232355295-232355317 AAGACAGACACTTAAGCCAGTGG No data
923271046_923271048 6 Left 923271046 1:232355272-232355294 CCAGACACTGAGCACATGACTAG No data
Right 923271048 1:232355301-232355323 GACACTTAAGCCAGTGGCCCAGG No data
923271046_923271049 13 Left 923271046 1:232355272-232355294 CCAGACACTGAGCACATGACTAG No data
Right 923271049 1:232355308-232355330 AAGCCAGTGGCCCAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923271046 Original CRISPR CTAGTCATGTGCTCAGTGTC TGG (reversed) Intergenic
No off target data available for this crispr