ID: 923274751

View in Genome Browser
Species Human (GRCh38)
Location 1:232386362-232386384
Sequence TACGGTCTTAGTCTGCACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923274751_923274756 13 Left 923274751 1:232386362-232386384 CCATGGTGCAGACTAAGACCGTA No data
Right 923274756 1:232386398-232386420 ATGCCACCCTGAGTGAGGAGAGG No data
923274751_923274758 17 Left 923274751 1:232386362-232386384 CCATGGTGCAGACTAAGACCGTA No data
Right 923274758 1:232386402-232386424 CACCCTGAGTGAGGAGAGGAAGG No data
923274751_923274761 21 Left 923274751 1:232386362-232386384 CCATGGTGCAGACTAAGACCGTA No data
Right 923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG No data
923274751_923274755 8 Left 923274751 1:232386362-232386384 CCATGGTGCAGACTAAGACCGTA No data
Right 923274755 1:232386393-232386415 AGGAGATGCCACCCTGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923274751 Original CRISPR TACGGTCTTAGTCTGCACCA TGG (reversed) Intergenic
No off target data available for this crispr