ID: 923274754

View in Genome Browser
Species Human (GRCh38)
Location 1:232386380-232386402
Sequence GGCATCTCCTGTGCCACATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923274754_923274761 3 Left 923274754 1:232386380-232386402 CCGTATGTGGCACAGGAGATGCC No data
Right 923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG No data
923274754_923274755 -10 Left 923274754 1:232386380-232386402 CCGTATGTGGCACAGGAGATGCC No data
Right 923274755 1:232386393-232386415 AGGAGATGCCACCCTGAGTGAGG No data
923274754_923274756 -5 Left 923274754 1:232386380-232386402 CCGTATGTGGCACAGGAGATGCC No data
Right 923274756 1:232386398-232386420 ATGCCACCCTGAGTGAGGAGAGG No data
923274754_923274764 16 Left 923274754 1:232386380-232386402 CCGTATGTGGCACAGGAGATGCC No data
Right 923274764 1:232386419-232386441 GGAAGGAAGGTCACGACCTGGGG No data
923274754_923274762 14 Left 923274754 1:232386380-232386402 CCGTATGTGGCACAGGAGATGCC No data
Right 923274762 1:232386417-232386439 GAGGAAGGAAGGTCACGACCTGG No data
923274754_923274758 -1 Left 923274754 1:232386380-232386402 CCGTATGTGGCACAGGAGATGCC No data
Right 923274758 1:232386402-232386424 CACCCTGAGTGAGGAGAGGAAGG No data
923274754_923274763 15 Left 923274754 1:232386380-232386402 CCGTATGTGGCACAGGAGATGCC No data
Right 923274763 1:232386418-232386440 AGGAAGGAAGGTCACGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923274754 Original CRISPR GGCATCTCCTGTGCCACATA CGG (reversed) Intergenic
No off target data available for this crispr