ID: 923274761

View in Genome Browser
Species Human (GRCh38)
Location 1:232386406-232386428
Sequence CTGAGTGAGGAGAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923274754_923274761 3 Left 923274754 1:232386380-232386402 CCGTATGTGGCACAGGAGATGCC No data
Right 923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG No data
923274751_923274761 21 Left 923274751 1:232386362-232386384 CCATGGTGCAGACTAAGACCGTA No data
Right 923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923274761 Original CRISPR CTGAGTGAGGAGAGGAAGGA AGG Intergenic
No off target data available for this crispr