ID: 923276232

View in Genome Browser
Species Human (GRCh38)
Location 1:232399371-232399393
Sequence ATGTACTTTTTGAGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 650
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 610}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923276228_923276232 19 Left 923276228 1:232399329-232399351 CCTAAGCTGGGCTACGAGAATCT 0: 1
1: 0
2: 0
3: 10
4: 63
Right 923276232 1:232399371-232399393 ATGTACTTTTTGAGGGGAGAAGG 0: 1
1: 0
2: 1
3: 38
4: 610
923276227_923276232 22 Left 923276227 1:232399326-232399348 CCTCCTAAGCTGGGCTACGAGAA 0: 1
1: 0
2: 0
3: 5
4: 47
Right 923276232 1:232399371-232399393 ATGTACTTTTTGAGGGGAGAAGG 0: 1
1: 0
2: 1
3: 38
4: 610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923276232 Original CRISPR ATGTACTTTTTGAGGGGAGA AGG Intronic
901307571 1:8243849-8243871 TTGTATTTTTTTAGTGGAGATGG - Intergenic
901520832 1:9783683-9783705 TTGTATTTTTTTAGTGGAGACGG - Intronic
901590586 1:10338262-10338284 AGGCACATTCTGAGGGGAGAGGG - Intronic
901907210 1:12423773-12423795 ATGACCTTGTTGAGGAGAGAGGG + Intronic
902836142 1:19047870-19047892 ATGAACCTGTTTAGGGGAGAAGG + Intergenic
903097026 1:20986571-20986593 TTGTATTTTTTTAGTGGAGACGG - Intronic
903467783 1:23564293-23564315 AGGTCCTTTGTGAGGGCAGAAGG - Intergenic
903972308 1:27126989-27127011 ATTTATTTTTTGCGGGGGGAGGG + Intronic
904102836 1:28047361-28047383 AAGTTCTTTTTAAGGGGTGATGG + Intronic
904896935 1:33824607-33824629 AAGTACTTATTGAGGAGAGAAGG - Intronic
905025985 1:34849808-34849830 TTGTACTTTTTTAGTAGAGACGG - Intronic
906421405 1:45671154-45671176 AGGTATATTATGAGGGGAGATGG - Intronic
907812730 1:57888143-57888165 ATGTTTTCTTTGAGGGGGGATGG + Intronic
907864576 1:58387383-58387405 ATGTTCTTTTTCATGGGGGAAGG + Intronic
908295935 1:62713180-62713202 TTGTACTTTTTGTAGAGAGAGGG - Intergenic
908499323 1:64727271-64727293 TTGTACTTTTTTAGTAGAGACGG - Intergenic
908515852 1:64892273-64892295 ATGTGCTTTTTTGGGGGGGATGG + Intronic
908622831 1:66004849-66004871 ATTTATTTTTTGAGTGGAGAAGG + Intronic
908748653 1:67399179-67399201 ATGCAGTTTTTCGGGGGAGAAGG + Intergenic
909019420 1:70414339-70414361 TTGTACTTTTTTAGTAGAGATGG - Intronic
909021251 1:70433763-70433785 ATGTAATTTTTGGGGGGGGAGGG - Intronic
909338245 1:74501657-74501679 TTGTACTTTTTTAGTAGAGACGG + Intronic
909831186 1:80192084-80192106 ATCTAATTTCTGAGGAGAGAAGG - Intergenic
910172676 1:84394592-84394614 ATGTACTTGTTGTGGGAGGATGG - Intergenic
910642503 1:89479225-89479247 ATGGACATATTGAGGGGATATGG + Intergenic
910818400 1:91317734-91317756 ATAAACATTTTGAGGGGAAATGG - Intronic
910835499 1:91504871-91504893 ATGTACTTTTTTAGGTGCTAGGG + Intronic
911753281 1:101523371-101523393 TTGTACTTTTTTAGTAGAGATGG - Intergenic
913012722 1:114700464-114700486 ATGTTCTGTTAGAGGAGAGAGGG + Intergenic
913586335 1:120278724-120278746 TTGTACTTTTTAAGTAGAGATGG - Intergenic
913621851 1:120619646-120619668 TTGTACTTTTTAAGTAGAGATGG + Intergenic
914568344 1:148890581-148890603 TTGTACTTTTTAAGTAGAGATGG - Intronic
914604481 1:149239668-149239690 TTGTACTTTTTAAGTAGAGATGG + Intergenic
915498537 1:156298481-156298503 TTGTATTTTTTAAGTGGAGACGG + Intergenic
915591372 1:156872847-156872869 TTGTATTTTTTTAGTGGAGACGG + Intronic
916086342 1:161272737-161272759 ATTTACTTCTTAAGGAGAGAGGG + Intronic
916950271 1:169772985-169773007 TTGTACTTTTTAAGAGAAGAAGG - Intronic
917428389 1:174939383-174939405 TTGTACTTTTTTAGTAGAGACGG - Intronic
917480247 1:175405661-175405683 GTGTGCTTTTTGAGGGGGCAGGG + Intronic
917683228 1:177389195-177389217 TAGTATTTTTTGAGGGGAGGAGG + Intergenic
917697894 1:177546850-177546872 ATGGATTTTGTGAGGGAAGATGG - Intergenic
917810698 1:178655607-178655629 TTGTACTTTTTTAGTAGAGATGG - Intergenic
918163792 1:181925289-181925311 TTGTATTTTTTGAGGAGACAGGG + Intergenic
918477433 1:184940159-184940181 ATGTCCTTTTTCAGGGCACAGGG - Intronic
918504925 1:185243280-185243302 TTGTACTTTTTGTAGGGACAGGG + Intronic
918658604 1:187061066-187061088 TGGAACTTTTTGAGGGGAGGGGG + Intergenic
919289329 1:195609351-195609373 ATCTCTTTTTTGAGCGGAGAGGG + Intergenic
919676456 1:200388442-200388464 ATTTAATTTTTGATTGGAGATGG - Intergenic
920294819 1:204949590-204949612 GTGTGCTTTTTGTGGGGACAAGG - Intronic
921767656 1:218991344-218991366 ATTTAATTTTAGAGTGGAGAAGG - Intergenic
921867270 1:220098703-220098725 AGGAACTTTTTTTGGGGAGAAGG + Intronic
922336173 1:224619728-224619750 ATGTACTTCTTGATCGGACAAGG + Intronic
922553477 1:226515067-226515089 ATGTCCAATTTTAGGGGAGAAGG - Intergenic
922744969 1:228038449-228038471 TTGTCCTTTTTCAGGGGCGATGG + Intronic
922953419 1:229578638-229578660 TTGTACTTTTTTAGTGGAGGTGG + Intergenic
922963761 1:229670280-229670302 ATGTACTTTTTACTGGGAGCAGG - Intergenic
923276232 1:232399371-232399393 ATGTACTTTTTGAGGGGAGAAGG + Intronic
923522776 1:234748800-234748822 ATGCATTTTTTTAGAGGAGAGGG - Intergenic
923699486 1:236286304-236286326 ATTTCCTTTTTTTGGGGAGATGG + Intergenic
924667205 1:246085420-246085442 ATAACCTTTTTCAGGGGAGAAGG - Intronic
1063613385 10:7582046-7582068 TTGTACTTTTTTAGTAGAGACGG + Intronic
1063638334 10:7806482-7806504 TTGTACTTTTTTAGTAGAGACGG - Intronic
1064076683 10:12274488-12274510 GTGTATTTTTTTAGTGGAGATGG + Intergenic
1064500157 10:15962640-15962662 GTGAACTTTTTGCGGGGAGGAGG + Intergenic
1065023362 10:21518418-21518440 ATTTACTTTGGGAGGGGAGGTGG - Exonic
1065507846 10:26447199-26447221 TTGTACTTTTTTAGTAGAGATGG - Intronic
1065962545 10:30745659-30745681 TTGTATTTTTTTAGTGGAGACGG + Intergenic
1066359869 10:34719681-34719703 ATGTCCTTTTGGAGGGGAGAAGG - Intronic
1068294757 10:55055628-55055650 TTGTACTTTTTGAAGGGATAAGG - Intronic
1068369860 10:56098327-56098349 ATGTATTTTTTGGAGAGAGAGGG - Intergenic
1068420935 10:56792175-56792197 CTGTTGTTTTAGAGGGGAGATGG - Intergenic
1068700910 10:60018674-60018696 TTGTATTTTTTTAGGAGAGATGG - Intergenic
1068800450 10:61134408-61134430 ATCTAATTTTTGTTGGGAGAGGG - Intergenic
1068964653 10:62899740-62899762 CTGTAATTTTTAAGAGGAGAGGG - Intronic
1069040234 10:63688384-63688406 TTGTATTTTTTTAGTGGAGATGG - Intergenic
1069178000 10:65318590-65318612 ATGTCATTTTGGAGGGGAAATGG + Intergenic
1069271267 10:66530853-66530875 AAGTATTTTTTAAGAGGAGAAGG + Intronic
1070029710 10:72665210-72665232 TTGTATTTTTTGTAGGGAGACGG + Intergenic
1070210574 10:74316065-74316087 TTGTATTTTTTTAGGAGAGACGG - Intronic
1071415959 10:85441619-85441641 AAGGACTTTGTGTGGGGAGAAGG - Intergenic
1071445571 10:85743150-85743172 CTGTACTTTTTGCGGGCAGCTGG - Intronic
1071574021 10:86712885-86712907 TTGTACTTTTTTAGTAGAGACGG - Intronic
1071584042 10:86801884-86801906 TTGTACTTTTTTAGTAGAGACGG + Intronic
1072449257 10:95526372-95526394 ATCTAACTTTTGAGGGGAGTTGG + Intronic
1072458514 10:95598399-95598421 TTGTATTTTTTTAGGAGAGACGG + Intergenic
1073869268 10:107843836-107843858 ATTTAGTATTTGTGGGGAGAAGG - Intergenic
1073884007 10:108016920-108016942 CAGAAATTTTTGAGGGGAGAAGG + Intergenic
1074270192 10:111945764-111945786 ATGTTCATTTGGAGGAGAGAGGG - Intergenic
1074937018 10:118191700-118191722 ATATAGGTTTTGATGGGAGAAGG + Intergenic
1075213525 10:120511918-120511940 TTGTACTTTTTTAGTAGAGATGG - Intronic
1075689926 10:124387832-124387854 ATGTCCTGCTTCAGGGGAGAAGG - Intergenic
1075768892 10:124917063-124917085 ATGTCCTGACTGAGGGGAGAGGG + Intergenic
1075886399 10:125903157-125903179 CTTTACTTCTTGATGGGAGAAGG + Intronic
1075928945 10:126277606-126277628 ATGTACTTTGCTAAGGGAGACGG + Intronic
1075930939 10:126295162-126295184 TTCTATTTTTTGGGGGGAGAGGG - Intronic
1077035743 11:493742-493764 TTGTACTTTTTGTAGGGACAGGG - Intergenic
1077988462 11:7379361-7379383 ATGTACTTTAAAAGGGGATATGG - Intronic
1079306399 11:19327286-19327308 ATGTAGTCAGTGAGGGGAGAGGG - Intergenic
1079462736 11:20698380-20698402 ATGTACTATTTGATGGCAGAAGG - Intronic
1081190424 11:40097577-40097599 TTGTACTTTTTTAGTAGAGACGG + Intergenic
1081295794 11:41387551-41387573 GAGTATTTTTTGAGGAGAGATGG + Intronic
1081411093 11:42759319-42759341 TTGTATTTTTTTAGGAGAGATGG - Intergenic
1081711985 11:45223141-45223163 TTGTACTTTTTGTGGAGATAGGG - Intronic
1082695463 11:56358374-56358396 ATTTAGTTTTTGAGGGGGTAGGG - Intergenic
1083039990 11:59676416-59676438 ATGTTCTTTTTGCGGGCAGGGGG + Intergenic
1083626755 11:64075842-64075864 TTGTACTTTTTTAGTAGAGACGG + Intronic
1084281301 11:68096191-68096213 TTGTACTTTTTTAGTAGAGACGG - Intronic
1085191078 11:74623259-74623281 TTGTATTTTTTTAGGAGAGATGG - Intronic
1086372440 11:86168670-86168692 ATGTACAGTTTGAGGGTAGGAGG - Intergenic
1086655015 11:89343553-89343575 ATCTACTTTTTTGAGGGAGATGG + Intronic
1086872148 11:92050733-92050755 ATGTGCTATTTCAGGGTAGAAGG - Intergenic
1087250128 11:95889505-95889527 ATGTCTTTTTTGGGGGGGGAGGG + Intronic
1087562346 11:99806318-99806340 ATTTATTTTTTTAGGGGATAAGG - Intronic
1088778657 11:113112351-113112373 ATCTACTTTTAGAGGTCAGAAGG - Intronic
1089025098 11:115260844-115260866 TTGTATTTTTTTAGTGGAGACGG + Intronic
1089469610 11:118710118-118710140 TTGTACTTTTTTAGTAGAGATGG + Intergenic
1089568334 11:119384955-119384977 ATGTCCCTGATGAGGGGAGAAGG + Intergenic
1090210771 11:124919902-124919924 ATCTACTGTGTGAGGAGAGAGGG - Exonic
1091162968 11:133442763-133442785 GTGTCTTTTTTGAGGGAAGAAGG + Intronic
1091402898 12:191345-191367 ATGAACCGTTTGAGGTGAGAAGG + Intronic
1092104167 12:5909247-5909269 AAGTACTTGTTGAGGGCAAAAGG - Intronic
1092189275 12:6506414-6506436 TTGTACTTTTTTAGTAGAGACGG - Intronic
1093613649 12:21194185-21194207 TTGTACTTTATTAGTGGAGACGG + Intronic
1094247756 12:28320980-28321002 ATATTCTGTTTGAGGGAAGAAGG + Intronic
1094555021 12:31490437-31490459 TTGTACTTTTTGAGGAGACGGGG - Intronic
1095503014 12:42861085-42861107 TTCTACTTTTTAAGGAGAGAAGG + Intergenic
1096165218 12:49416865-49416887 CTCTACCTTTTGATGGGAGAAGG + Intronic
1096308607 12:50500916-50500938 TTTTACTTTTTGTGGGGACAGGG - Intergenic
1096827175 12:54288726-54288748 TTGTACTTTTTTAGCAGAGACGG - Intergenic
1096849999 12:54429228-54429250 AAGAACTGTTAGAGGGGAGAAGG - Intergenic
1096851507 12:54441320-54441342 TTGTACTTTTTTAGTAGAGATGG - Intergenic
1097228832 12:57496334-57496356 TTGTACTTTTTTAGTAGAGACGG + Intronic
1097795060 12:63852430-63852452 ATGTGCTTTTAGAGTGGAGTGGG + Intronic
1097853480 12:64437036-64437058 ATGTTCTTTTTAGGGGGTGAGGG - Intronic
1098415379 12:70229239-70229261 TTGTACTTTTTTAGTAGAGACGG + Intergenic
1098874915 12:75857055-75857077 ATATACTTTTTTAAGGGTGAAGG - Intergenic
1099020672 12:77400471-77400493 ATTTATTTTTTGATGAGAGAAGG + Intergenic
1099037504 12:77607524-77607546 ATTTACATTTTGAAAGGAGATGG + Intergenic
1099612861 12:84897018-84897040 TTGTATTTTTTTAGGGGAGAGGG - Intronic
1099670571 12:85686556-85686578 TTGTACTTTTTTAGTAGAGACGG - Intergenic
1100532387 12:95472664-95472686 ATTTACTTTTTTGGGGGGGATGG + Intergenic
1101723426 12:107370546-107370568 ATCTATTTTTTCAGGGGAAAGGG - Intronic
1101955816 12:109211760-109211782 ATGTACACTTTAAAGGGAGATGG + Intronic
1102145120 12:110649380-110649402 GTCTTCTTTTTGAGGGGAGCTGG + Exonic
1102324270 12:111965751-111965773 ATTTTTTTTTTTAGGGGAGACGG - Intronic
1103409666 12:120701778-120701800 TTGTACTTTTTGGTGGGAGTGGG - Exonic
1103439788 12:120954686-120954708 TTGTATTTTTTGAGTAGAGATGG + Intergenic
1103580040 12:121908159-121908181 AATTTATTTTTGAGGGGAGAGGG - Intronic
1103883687 12:124185645-124185667 TTGTATTTTTTTAGGAGAGATGG - Intronic
1104061703 12:125274010-125274032 AGGTTCTTTCTGAGGGGAGAGGG - Intronic
1104432795 12:128730321-128730343 TTGTACTTTTTGTGGAGACAGGG - Intergenic
1104705935 12:130947599-130947621 ATGTGAATTTTGGGGGGAGAAGG - Intergenic
1104907606 12:132222405-132222427 ATCTACTTTTTGTGAGGAGATGG - Intronic
1105000186 12:132686045-132686067 TTGTATTTTTTTAGTGGAGACGG + Intronic
1106498135 13:30301195-30301217 TTGTACTTTTTTAGTAGAGACGG - Intronic
1107220673 13:37975592-37975614 ATGTACTTTTAAAAGGAAGAGGG + Intergenic
1108123713 13:47217713-47217735 TTGTACTTTTTTAGTAGAGACGG + Intergenic
1108206994 13:48100346-48100368 TTGTACTTTTTTAGTAGAGATGG - Intergenic
1108216089 13:48186017-48186039 ATATATTTTTTTAGTGGAGACGG - Intergenic
1108448695 13:50537057-50537079 ATGAACTTCTTATGGGGAGAGGG - Intronic
1108915378 13:55604367-55604389 TTGTATTTTTTTAGTGGAGATGG - Intergenic
1109157105 13:58924890-58924912 ATGTCCTCTTTGAGTGAAGATGG + Intergenic
1109872296 13:68348797-68348819 AAGTAATTTTTAAGTGGAGAAGG - Intergenic
1109903332 13:68803578-68803600 ATATATTTTTTGAGGGAGGATGG - Intergenic
1110146890 13:72202859-72202881 ATGCACTTTTTCAGCAGAGATGG - Intergenic
1110338749 13:74364374-74364396 ATGACCTGTTTCAGGGGAGAAGG - Intergenic
1111995081 13:95157896-95157918 TTGTACTTTTTTAGTAGAGACGG - Intronic
1112297112 13:98197806-98197828 TTGTACTTTTTTAGTAGAGACGG + Intronic
1112735993 13:102418946-102418968 TTGTATTTTTTTAGTGGAGATGG - Intergenic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1114496564 14:23137053-23137075 CTGTACTTTCTGAGGGCAGGGGG + Intronic
1114861866 14:26532716-26532738 TTGTACCTTTTGAGGGCAGAGGG + Intronic
1114887849 14:26877048-26877070 ATGTATTTATGGAGGGGAAAAGG - Intergenic
1115337576 14:32257178-32257200 ATGTATTTTTTTAGTAGAGATGG + Intergenic
1115828912 14:37312279-37312301 TTGTACTTTTTTAGTAGAGATGG + Intronic
1116100826 14:40432911-40432933 AACTTCTTTTTGAGGGGAGAGGG - Intergenic
1116449831 14:45051730-45051752 TTGTATTTTTTTAGGAGAGACGG + Intronic
1116819162 14:49610964-49610986 CTGAACTTTTTTAGGGGAGAGGG + Intronic
1117257749 14:53997207-53997229 ATGTAGTTTTTGGGGTCAGAAGG + Intergenic
1118009447 14:61594468-61594490 ATGTAGTAGTTGTGGGGAGATGG + Intronic
1118547770 14:66912745-66912767 ATGTACTTTTTAAGGAAAGATGG + Intronic
1118567595 14:67159129-67159151 ATGTACTTTCTGTGAGGACAGGG + Intronic
1119100072 14:71871440-71871462 GTGTACGTTCTGAGGAGAGAAGG - Intergenic
1119331985 14:73801643-73801665 CTGTACTTTTTGTAGGGACAGGG + Intergenic
1119470466 14:74894717-74894739 TTGTATTTTTTTAGTGGAGACGG + Intronic
1119712781 14:76834959-76834981 TTTTCCTTTTTCAGGGGAGAGGG + Intronic
1120222994 14:81756723-81756745 ATGTACTCTTTTAGTGGGGAGGG - Intergenic
1120373970 14:83676476-83676498 GTGTACTTTTTGGAGGAAGAAGG - Intergenic
1120923374 14:89774708-89774730 ATGTAATTTTTGTGGGGGCAGGG - Intergenic
1121162895 14:91761495-91761517 TTGTACTTTTTTAGTAGAGACGG - Intronic
1121594545 14:95150311-95150333 TTGTATTTTTTAAGTGGAGACGG - Intronic
1121834672 14:97081094-97081116 ATGAACTTTTTTGGGGAAGAGGG + Intergenic
1122315382 14:100823250-100823272 ATGGCCTTTTTGAGGGAGGAAGG + Intergenic
1122734006 14:103824521-103824543 TTGTACTTTTTTAGTAGAGATGG - Intronic
1123754098 15:23383182-23383204 TTGTACTTTTTTAGTAGAGATGG + Intergenic
1124478581 15:30058515-30058537 TTGTATTTTTTTAGGAGAGACGG + Intergenic
1125512585 15:40300770-40300792 ATGTTTTTTTTGGGGGGGGAAGG - Intronic
1126009042 15:44285182-44285204 TTTTTTTTTTTGAGGGGAGATGG - Intergenic
1126271233 15:46819384-46819406 ATGTGCTATTTGATAGGAGATGG - Intergenic
1127149751 15:56061100-56061122 ATGTAATTTTTGTAGAGAGAAGG - Intergenic
1127261632 15:57330955-57330977 AGGTTCTTTTTGTGGTGAGAGGG - Intergenic
1127357354 15:58213224-58213246 ATGTACAAAATGAGGGGAGAGGG - Intronic
1127518481 15:59719331-59719353 TTGTACTTTTTTAGTTGAGACGG - Intergenic
1128276299 15:66356594-66356616 ATGAAGTTCTTGCGGGGAGAGGG - Intronic
1128424463 15:67525839-67525861 TTGTACTTTTTTAGTAGAGATGG - Intronic
1128653454 15:69438626-69438648 TTGTACTTTTTTAGTAGAGATGG - Intronic
1128921971 15:71619140-71619162 TTGTATTTTTTTAGTGGAGATGG + Intronic
1129527733 15:76232152-76232174 TTGTAATTATTGAGGGCAGAGGG - Intronic
1130076086 15:80691718-80691740 ATGCACTTGTTGAGGGCAGGAGG + Intronic
1130505773 15:84539989-84540011 TTGTATTTTTTTAGTGGAGATGG - Intergenic
1130531491 15:84750129-84750151 TTGTATTTTTTTAGTGGAGACGG - Intronic
1130844694 15:87733938-87733960 ATGGAGTGTCTGAGGGGAGAAGG - Intergenic
1133164128 16:3934630-3934652 TTGTACTTTTTCAGTAGAGATGG + Intergenic
1134462290 16:14439840-14439862 TTGTACTTTTTTAGTAGAGATGG - Intronic
1135649464 16:24193270-24193292 TTGTACTTTTTTAGTAGAGATGG - Intronic
1136236560 16:28917590-28917612 CTGTACTTTTTTAGTAGAGACGG + Intronic
1139056655 16:63194002-63194024 TTGTACTTTTTCAGTAGAGACGG - Intergenic
1139058548 16:63219947-63219969 ATGTTCTTGTCCAGGGGAGAAGG - Intergenic
1139444737 16:66990221-66990243 TTGTATTTTTTTAGTGGAGATGG + Intronic
1139559535 16:67733190-67733212 TTGTATTTTTTGTGGGGACAGGG - Intronic
1139716790 16:68820024-68820046 ATGTACTTTTTGTAGAGACAGGG - Intronic
1139766836 16:69237772-69237794 TTGTATTTTTTGAGTAGAGACGG + Intronic
1139918515 16:70443254-70443276 ATGTATTTTTAGTAGGGAGAGGG - Intergenic
1140286548 16:73607895-73607917 TTGTACTTTTTGAAGTGACAGGG - Intergenic
1140492203 16:75347168-75347190 TTGTACTTTTAGTGGGGACAGGG - Intronic
1140556689 16:75929591-75929613 TTGTACTTTTTTAGCAGAGATGG - Intergenic
1141325800 16:83058195-83058217 CTCTCCTTTGTGAGGGGAGATGG + Intronic
1141672716 16:85501172-85501194 TTGTACTTTTTTAGTAGAGACGG + Intergenic
1142609078 17:1098246-1098268 TTGTACTTTTTTAGTAGAGACGG + Intronic
1143592338 17:7893208-7893230 ATTTAATTGATGAGGGGAGATGG + Intronic
1143859332 17:9876634-9876656 ATGACCTGTTTCAGGGGAGAAGG + Intronic
1144149570 17:12430170-12430192 TTGTACTTTTTTAGTAGAGACGG + Intergenic
1144410060 17:14992118-14992140 ATGAACTGCTTCAGGGGAGAAGG + Intergenic
1144800647 17:17923963-17923985 TTGTATTTTTTTAGTGGAGACGG - Intronic
1145979901 17:29005326-29005348 GTGTTCTTACTGAGGGGAGACGG - Intronic
1146394867 17:32456701-32456723 TTGTAATTTTTTAGGAGAGATGG + Intronic
1146798144 17:35797447-35797469 CTGTTCTTTTTGGGGGGATATGG + Intronic
1147197294 17:38775683-38775705 TTGTATTTTTTTAGTGGAGACGG - Intronic
1148604077 17:48915681-48915703 ATGGAGTTAGTGAGGGGAGAGGG - Intronic
1148643449 17:49205312-49205334 ATTTGCTTTTTTGGGGGAGAGGG - Intronic
1148729576 17:49824529-49824551 TTGTATTTTTTTAGTGGAGACGG + Intronic
1149545175 17:57498114-57498136 ATTTACTTTTTAAGGGTAGCGGG - Intronic
1149776311 17:59360248-59360270 TTGTACTTTTTTAGTAGAGACGG + Intronic
1149788103 17:59453542-59453564 TTGTACTTTTTTAGTAGAGACGG + Intergenic
1150223894 17:63512343-63512365 TTGTATTTTTTGTGGGGACAGGG + Intronic
1150272511 17:63875827-63875849 TTGTACTTTTTTAGTAGAGACGG + Intronic
1150278154 17:63913105-63913127 TTGTACTTTTTTAGTAGAGACGG + Intronic
1150316135 17:64170803-64170825 TTGTACTTTTTTAGTAGAGACGG + Intronic
1150334091 17:64317728-64317750 TTGTATTTTTTTAGTGGAGATGG - Intergenic
1151941955 17:77298294-77298316 ATGAACTTAGTGAGGGGAGATGG - Intronic
1152524782 17:80881815-80881837 ATTTATTTATTGAGTGGAGACGG - Intronic
1152803979 17:82346106-82346128 TTGTATTTTTTTAGTGGAGACGG - Intergenic
1155381050 18:25223239-25223261 ATTTACTTGGGGAGGGGAGAAGG + Intronic
1156004948 18:32429023-32429045 AGTTATTTTTTGAGAGGAGAGGG - Intronic
1156342701 18:36225322-36225344 TTGTACTTTTTGTAGAGAGAGGG + Intronic
1156361372 18:36387176-36387198 GTGTCCTGCTTGAGGGGAGATGG + Intronic
1156399917 18:36730946-36730968 TTAAACTTTTTGAGGGGAGGGGG + Intronic
1157854503 18:51092648-51092670 TTGTATTTTTTGTGGGGACAAGG + Intergenic
1157873369 18:51250089-51250111 ATGTGAATTTTGAGGGGAGAGGG + Intergenic
1158666511 18:59437686-59437708 TTGCACTTTTTAAGAGGAGATGG + Intronic
1158711372 18:59841102-59841124 CTTTGCTTTTTCAGGGGAGATGG + Intergenic
1158769054 18:60492617-60492639 ATGTATTTTTTGGGGGTACATGG + Intergenic
1159470617 18:68850613-68850635 ATGGATGTTTTGAGTGGAGAAGG + Intronic
1161019761 19:2003299-2003321 TTGTACTTTTTTAGCAGAGACGG - Intronic
1162139952 19:8579784-8579806 TTGTACTTTTTTAGTAGAGACGG - Intergenic
1162453668 19:10769548-10769570 CTGCACTCTTTGAAGGGAGATGG + Intronic
1163092279 19:15028865-15028887 ATTTATTTTTTGATGGAAGAAGG + Intergenic
1163504851 19:17699516-17699538 TTGTAATTTTTTAGTGGAGACGG - Intergenic
1164631366 19:29763960-29763982 TTGTATTTTTTTAGTGGAGACGG + Intergenic
1164836707 19:31359667-31359689 TTGTATTTTTTGTGGAGAGAGGG - Intergenic
1165063599 19:33216748-33216770 TTGTACTTTTTTAGTAGAGATGG + Intronic
1165320638 19:35083208-35083230 ATTTTTTTTTTGAGGGGGGATGG + Intergenic
1165488932 19:36112199-36112221 TTGTTTTTTTTGAGGGGGGATGG - Intronic
1165639567 19:37372643-37372665 TTGTACTTTTTGAGGAGATGGGG + Intronic
1165935091 19:39384260-39384282 CTGAACTTTATGAGGGGAGAGGG + Exonic
1166255073 19:41598309-41598331 TTGTACTTTTTTAGTAGAGATGG - Intronic
1166284596 19:41816657-41816679 TTGTACTTTTTTAGTAGAGACGG + Intergenic
1166878407 19:45912281-45912303 ATATATTTTTTTAGTGGAGATGG - Intergenic
1167041984 19:47027905-47027927 GGGGACATTTTGAGGGGAGAGGG + Intronic
1167067122 19:47194913-47194935 ATGTATTTTTTTAGTAGAGACGG + Intronic
1167194887 19:48021618-48021640 ATGTATTTTTTTAGTAGAGATGG + Intronic
1167344635 19:48937503-48937525 TTGTACTTTTTTAGTAGAGACGG - Intronic
1167531840 19:50022613-50022635 TTGTACTTTTTTAGTAGAGACGG - Intronic
1167755209 19:51408643-51408665 TTGTATTTTTTTAGGTGAGACGG + Intergenic
1168023113 19:53624258-53624280 TTGTACTTTTTTAGTAGAGACGG + Intergenic
1168023604 19:53627607-53627629 TTGTACTTTTTTAGCAGAGACGG + Intergenic
925727889 2:6892133-6892155 ATGTATTTTTGGATGGCAGATGG - Intronic
927585417 2:24299203-24299225 TTGTACTTTTTGTAGAGAGAGGG + Intronic
928193146 2:29192807-29192829 ATGAGCCATTTGAGGGGAGAGGG - Exonic
928453307 2:31398050-31398072 ATGAACTTTTTGAGAGTAGAGGG + Intronic
928733062 2:34255296-34255318 ATGTAGATTTTCAGGTGAGATGG + Intergenic
928745366 2:34407624-34407646 TTATACTTTTGGAGGTGAGAAGG - Intergenic
928924192 2:36560391-36560413 ATGTCATTTTTGGGGGAAGAAGG - Intronic
929153551 2:38769720-38769742 TTGTATTTTTTGAGGGGATGGGG + Intronic
929156902 2:38796439-38796461 CTGTATTTTTTTAGTGGAGATGG - Intergenic
929961340 2:46498447-46498469 ATGCCCTTTTTGGGGGGAAATGG - Intronic
930399026 2:50859532-50859554 AAGTCTTTTTTGAGGGGAAAAGG + Intronic
930643272 2:53876629-53876651 ATCTACTTTTGGAGGACAGAAGG - Intronic
931394645 2:61875404-61875426 TTGTATTTTTTGAGTAGAGATGG - Intronic
931875184 2:66504404-66504426 TTGTATTTTTTTAGTGGAGATGG + Intronic
932018326 2:68056273-68056295 TTGTATTTTTTTAGGAGAGACGG + Intronic
932161430 2:69463820-69463842 ATTTATTTTTTGAAGGGACAGGG + Intronic
932198497 2:69804873-69804895 TTGTATTTTTTAAGGAGAGATGG - Intronic
932580573 2:72990437-72990459 ATGCACTTTTTTGGGGGTGAGGG - Intronic
932830682 2:74986736-74986758 TTGTACTTTTTTAGTAGAGACGG + Intergenic
933000162 2:76911925-76911947 ATGTGCTTTTTGGGGGGGGGGGG + Intronic
933315339 2:80707803-80707825 TTGTATTTTTTCAGGAGAGACGG + Intergenic
935025267 2:99270619-99270641 AGGTACATTTTGATGGGACAAGG + Intronic
935221861 2:101022092-101022114 ATCTACTTTCTGAAGGGGGATGG - Intronic
935973546 2:108555194-108555216 CTTTATTTTTTGAGGGGGGAGGG + Intronic
936035398 2:109107108-109107130 TTGTATTTTTTTAGTGGAGATGG + Intergenic
936397758 2:112142003-112142025 AGGTGCTTTGTGAGGGGAAAGGG + Intronic
936505213 2:113100148-113100170 TTGTACTTTTTTAGTAGAGACGG - Intergenic
936764479 2:115830183-115830205 TTGTACTTTTTTAGCAGAGACGG - Intronic
937179415 2:119976908-119976930 TTGTCTTTTTTGGGGGGAGAGGG + Intronic
938099108 2:128486144-128486166 ATGTGCTTTGGGAGGTGAGAGGG + Intergenic
938644776 2:133319260-133319282 ATCTCATTTTTGAGGGTAGAGGG + Intronic
939068151 2:137508559-137508581 TTGTATTTTTTTAGTGGAGACGG + Intronic
940010174 2:149044967-149044989 ATGTATTTTTGGAGGGGACTAGG + Intronic
940932117 2:159445363-159445385 ATGTACTTTTTGTAGGGCTAAGG + Intronic
941461854 2:165781422-165781444 ATGTATTTTTTTTGTGGAGATGG - Intronic
941547408 2:166869270-166869292 ATGTATTTTTAGAGGGGAGTGGG + Intergenic
941822865 2:169859887-169859909 TTGTATTTTTTTAGTGGAGACGG + Intronic
941837687 2:170044061-170044083 AGGTTTTTTTTGAGGGGAGGTGG + Intronic
942001529 2:171652862-171652884 TTGTTCTTCTTGAGGGGAGGAGG - Intergenic
942212595 2:173686476-173686498 ATGGCCTGTTTCAGGGGAGAAGG - Intergenic
943068779 2:183117106-183117128 TTGTACTTTTTTAGTAGAGACGG + Intergenic
943309100 2:186304585-186304607 ATGACCTGTTTCAGGGGAGAAGG - Intergenic
944845876 2:203667217-203667239 TTGTACTTTTTTAGTAGAGACGG - Intergenic
945540002 2:211073360-211073382 TTGTATTTTTTGTGGGGACAGGG + Intergenic
945609735 2:211984900-211984922 ATTTATTTTTTTAGTGGAGACGG + Intronic
945713136 2:213325648-213325670 ATCTATTTTTTGAGGGGGGAAGG + Intronic
948416393 2:237808454-237808476 ATGCTTTTTTTGGGGGGAGAGGG - Intronic
1169464986 20:5829453-5829475 TCTTGCTTTTTGAGGGGAGAGGG - Intronic
1169962437 20:11176695-11176717 ATTTACTTTGTGAAGGCAGAAGG + Intergenic
1170734886 20:19006054-19006076 ATGTACTGATTGAGAGAAGAGGG + Intergenic
1172351932 20:34249846-34249868 ATGTGATTTTTCAGGGGAGAGGG - Intronic
1174331875 20:49826541-49826563 ATGTGCTTTTGGAGTGCAGATGG - Intronic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1174705958 20:52656452-52656474 TTGTACTTTTTTAGTAGAGACGG + Intergenic
1174811724 20:53651232-53651254 TTGTATTTTTTTAGTGGAGATGG - Intergenic
1175002019 20:55639675-55639697 ATTTACATTTTGATGGGAGGAGG + Intergenic
1175369938 20:58481516-58481538 ATTTAGGTTTTGAGGAGAGAGGG + Intronic
1175532606 20:59684488-59684510 CTGTACTTTTTGCCTGGAGATGG + Intronic
1175573127 20:60039133-60039155 TTGTACTTTTTTAGTAGAGACGG + Intergenic
1175908274 20:62392449-62392471 ATGTCCTTTTTGAGGTCTGAGGG + Exonic
1176119499 20:63447765-63447787 TTGTATTTTTTTAGTGGAGATGG + Intronic
1176134632 20:63516766-63516788 TTGTAATTTTTTAGTGGAGATGG + Intergenic
1176894445 21:14359951-14359973 ATGTACTTTTAGTTGGGACAGGG - Intergenic
1177314454 21:19438721-19438743 TTGTGATTTTTGAGGGGAGAGGG - Intergenic
1177493458 21:21858069-21858091 ATGTACTTTTTTGGGAGTGAGGG - Intergenic
1177607960 21:23406893-23406915 TTGTACTTTTTCAGTAGAGATGG + Intergenic
1177724678 21:24951504-24951526 CTCTGCATTTTGAGGGGAGAGGG - Intergenic
1177859330 21:26434589-26434611 TTGTACTTTTTTAGTAGAGACGG + Intergenic
1177968360 21:27757972-27757994 ATGTACTTGATGAGAGCAGACGG - Intergenic
1178325094 21:31638922-31638944 TTGTACTTTTTTAGCAGAGACGG - Intergenic
1178547042 21:33501051-33501073 TTGTACTTTTTTAGTAGAGACGG + Intergenic
1178848426 21:36192859-36192881 TTGTATTTTTTTAGTGGAGATGG + Intronic
1179021704 21:37646842-37646864 TTGTACTTTTTTAGTAGAGACGG + Intronic
1179608714 21:42534945-42534967 ATGTGCTTTTTGGTAGGAGAGGG - Intronic
1180097634 21:45566002-45566024 TTGTATTTTTTTAGGAGAGACGG - Intergenic
1180286406 22:10748670-10748692 CTTTACTTCTTGATGGGAGAAGG + Intergenic
1180710585 22:17836815-17836837 TTGTACTTTTTTAGTAGAGACGG + Intronic
1182040845 22:27237863-27237885 ATGTAGAATTTGAGGGGAGAGGG + Intergenic
1182771244 22:32797848-32797870 TTGGAGTTTTTGAGGCGAGAGGG + Intronic
1183127753 22:35801468-35801490 ATTTACTTTTGGCGGGGGGAGGG - Intronic
1183906259 22:41042700-41042722 ATGTACTTTTTGTGGGGGAAGGG + Intergenic
1184317797 22:43710786-43710808 ATGTTCATTTTGTGGGGAGTGGG - Intronic
1184957947 22:47904804-47904826 ATGTATTTTTTGTAGGGACAGGG - Intergenic
949381101 3:3446917-3446939 AGGTTCTTTATGAGGGCAGATGG - Intergenic
950032936 3:9863822-9863844 ATGTATTTTTTGTGGGGTGGGGG - Intergenic
950631649 3:14285941-14285963 ATGTAATTTTGGAGGGGTCATGG + Intergenic
950989304 3:17415330-17415352 TTGTACTTTTTTAGTAGAGACGG + Intronic
951016703 3:17740145-17740167 ATGTTCTTTTTTAGTAGAGACGG - Intronic
952017754 3:28978645-28978667 ATATAATTTTAGATGGGAGAAGG - Intergenic
952791678 3:37205510-37205532 TTGTATTTTTTTAGTGGAGATGG - Intergenic
954207144 3:49068182-49068204 TTTTACTTTTTGTGGAGAGAGGG - Intronic
954341083 3:49954265-49954287 TTGTATTTTTTTAGTGGAGACGG - Intronic
954642892 3:52112466-52112488 TTGTACTTTTTTAGTAGAGATGG - Intronic
956691571 3:71882704-71882726 TTGTACTTTTTGAAGAGACAGGG + Intergenic
957853216 3:85838557-85838579 ATATACTTTTTTGGAGGAGAGGG + Intronic
958069679 3:88593985-88594007 TTGTATTTTTTTAGTGGAGACGG - Intergenic
958560003 3:95735973-95735995 ATGTATTTTTTTAATGGAGATGG - Intergenic
958685314 3:97386015-97386037 ATGAAATTTTTGAGGGGCCAAGG - Intronic
958864275 3:99482928-99482950 ATGTCCTTCTTTAGGGGAAAAGG - Intergenic
959071779 3:101708220-101708242 AAATTCTTTTTGTGGGGAGATGG + Intergenic
959276068 3:104278748-104278770 TTGTTTTTTTTGGGGGGAGAGGG - Intergenic
960554042 3:119007904-119007926 ATATATTTTCTGAGGGAAGAAGG - Intronic
960608673 3:119534197-119534219 ATGTATTTTCTTAGTGGAGATGG - Intronic
961237130 3:125376310-125376332 ACGTAACCTTTGAGGGGAGAGGG + Intergenic
961534126 3:127559073-127559095 TTGTATTTTTTTAGTGGAGACGG - Intergenic
961908852 3:130293322-130293344 CTGTACATTTTTAGGGGTGAGGG - Intergenic
962023946 3:131527636-131527658 ATGTATTTTTTTAGTGGAGACGG - Intergenic
962390056 3:134963756-134963778 TTGTAATTTTTGATGGGAGTTGG + Intronic
962574348 3:136742540-136742562 TTGTATTTTTTTAGTGGAGACGG - Intronic
962945287 3:140163638-140163660 ATTGACTTCTTGTGGGGAGAAGG + Intronic
963217056 3:142759996-142760018 TTGTATTTTTTTAGTGGAGATGG + Intronic
963429752 3:145184342-145184364 ATGTACTTTTTGGTGGTGGAGGG + Intergenic
964705574 3:159615294-159615316 TTGTACTTTCTGACGGGAGTGGG + Intronic
964750696 3:160051291-160051313 TTGTGGTTTTTGAGGGGTGAAGG + Intergenic
964835565 3:160934778-160934800 TTGTACTTTTTGTGGAGACAGGG - Intronic
965313457 3:167160688-167160710 ATTCACTTTTTGCTGGGAGAAGG - Intergenic
965718821 3:171638006-171638028 TTGTATTTTTTTAGTGGAGATGG - Intronic
966170951 3:177079257-177079279 TTGTATTTTTTTAGTGGAGACGG - Intronic
966381277 3:179347511-179347533 TTGGACACTTTGAGGGGAGAAGG + Intergenic
966943939 3:184764439-184764461 ATTTGCTTTTTGGGGGAAGAAGG + Intergenic
966980461 3:185129227-185129249 GTGGACTTTTAGAGGGCAGACGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967444142 3:189544958-189544980 AGGTACTGATTGAGGTGAGAAGG + Intergenic
967582685 3:191178691-191178713 TTGTACTTTTTTAGTAGAGATGG - Intergenic
967620703 3:191630150-191630172 TTATACTTTTTGAGTGCAGAGGG + Intergenic
968414816 4:421920-421942 ATGTACTTATTGAAGAGACAGGG + Intergenic
968576589 4:1369086-1369108 ATTGACTTCTTGAGGTGAGAGGG + Intronic
969940392 4:10725679-10725701 TTGTACTTTTTTAGTAGAGAAGG - Intergenic
970168038 4:13260798-13260820 CTGTACATTTTGAAAGGAGAAGG - Intergenic
971176151 4:24284499-24284521 ATGGACATTTTGAAGGGAAAAGG + Intergenic
971540961 4:27815821-27815843 TTCTACTGTTTGAGGGTAGAAGG - Intergenic
971624226 4:28897879-28897901 TTTTACTTTTTGTTGGGAGAGGG - Intergenic
971754797 4:30693810-30693832 ATGTACTTCTTAAGGGCACATGG - Intergenic
971995763 4:33962292-33962314 TTGTATTTTTTTAGTGGAGAAGG + Intergenic
972217114 4:36909723-36909745 GTGAACTTTGTGATGGGAGACGG - Intergenic
972585053 4:40430019-40430041 TTGTATTTTTTTAGTGGAGACGG - Intronic
973329087 4:48894318-48894340 TTGTATTTTTTTAGTGGAGACGG - Intronic
973781350 4:54290759-54290781 ATGTGCATGTTGTGGGGAGAGGG + Intronic
974256120 4:59457748-59457770 ATGTACTTTGGGATGGGAGAGGG - Intergenic
974934035 4:68392340-68392362 TTGTACTTTTTGTGGAGACAGGG - Intergenic
975756086 4:77572228-77572250 TTTTACATTTTTAGGGGAGATGG - Intronic
976442377 4:85089870-85089892 ATGAAATTTTGGAGGGGTGAGGG + Intergenic
976556617 4:86458125-86458147 TTGTATTTTTTTAGTGGAGACGG - Intronic
977408947 4:96636779-96636801 TTGTATTTTTTGAGTAGAGATGG + Intergenic
978249714 4:106615986-106616008 TCTTACTTTTTGAGGGGGGAGGG - Intergenic
978593764 4:110354980-110355002 AGGAAGTTTTTGAAGGGAGAGGG - Intergenic
978760519 4:112352328-112352350 GTGGATTTTTTGAGGGGAGCAGG - Intronic
978918981 4:114159037-114159059 ATGAAGTTTTTGTGGGGAGGAGG - Intergenic
978990778 4:115079177-115079199 TTGTACTTTTTTAGTAGAGACGG - Intronic
979533390 4:121792879-121792901 TTGTATTTTTTGTGGGGACAGGG + Intergenic
979932599 4:126650299-126650321 ATTTACTTTTTCACAGGAGATGG + Intergenic
980764773 4:137287579-137287601 TTGTATTTTTTTAGTGGAGATGG + Intergenic
980883564 4:138738966-138738988 TCGTATTTTTTGCGGGGAGACGG + Intergenic
980893372 4:138837966-138837988 ATGTTTTTTTTGTGGGGAGGTGG + Intergenic
981191120 4:141864836-141864858 TTGTATTTTTTTAGTGGAGACGG + Intergenic
981504424 4:145482992-145483014 ATGTGCTTTAGGAGGGGAGGAGG + Exonic
981856730 4:149303213-149303235 AGGTGCTTTTTGAGGGCAGTAGG + Intergenic
982357683 4:154488730-154488752 CTGTATTTTTTTAGTGGAGATGG - Intronic
982711736 4:158764874-158764896 TTTTACTTTTTGTGGAGAGAGGG + Intergenic
984368727 4:178832871-178832893 ATGTACCTGTTGCGGGGAGGAGG - Intergenic
984502333 4:180571839-180571861 ATGTAGTTTTTGACTTGAGATGG - Intergenic
984657157 4:182330479-182330501 ATGTCCTGCTTCAGGGGAGAAGG + Intronic
984828753 4:183951766-183951788 TTGTATTTTTTGAGTAGAGACGG - Intronic
985229109 4:187796052-187796074 AGGAACTATTTGAAGGGAGAGGG - Intergenic
985284882 4:188327181-188327203 ATGTACCTTATGAGAGGAGGTGG + Intergenic
985798718 5:1986353-1986375 ATGTCTTTTTTGGGGGGACAGGG - Intergenic
985998082 5:3608284-3608306 ATGTACTCTTTCAGGAGGGAAGG - Intergenic
986944312 5:12996782-12996804 GTGTATTTCTTGAGGAGAGAAGG - Intergenic
986994610 5:13592749-13592771 ATTTACTTCTGGAGGGGAGAAGG - Intergenic
987568821 5:19628624-19628646 ATGAACTGTTTGTGGGGAGGTGG + Intronic
987577405 5:19747934-19747956 TTGTACTTTTTTAGTAGAGACGG - Intronic
988827042 5:34948089-34948111 ATATTCTTTTTGTGGGAAGAGGG + Intronic
988913327 5:35868294-35868316 ATTTTCTTTTTGAGGGTTGAAGG - Intronic
989502484 5:42184589-42184611 CTGAACATTTTGAGAGGAGAGGG - Intergenic
989664168 5:43833660-43833682 ATGTTTTTTTTGTGGGGGGAAGG + Intergenic
990240102 5:53808598-53808620 ATGTCCTTTTTGCAGGGACATGG + Intergenic
990968356 5:61474989-61475011 ATGTGCTTTTGGAGGGCTGAAGG - Intronic
991145173 5:63293876-63293898 ATGTATTTTTCAAGGGGGGAGGG + Intergenic
991350365 5:65714642-65714664 TTTTACTTTTTTAGCGGAGATGG - Intronic
992448868 5:76857669-76857691 TTGTATTTTTTTAGGAGAGACGG + Intronic
993016982 5:82545258-82545280 TTGTATTTTTTTAGGAGAGATGG - Intergenic
993674633 5:90802211-90802233 TTGTTCTTTTTTGGGGGAGAAGG + Intronic
993712379 5:91239066-91239088 TTGTATTTTTTCAGTGGAGACGG + Intergenic
993751720 5:91677607-91677629 TTCTACTTTTTTAGTGGAGACGG + Intergenic
994639580 5:102390165-102390187 ATGTATTTTTGAATGGGAGAGGG - Intronic
994757361 5:103810929-103810951 ATTTTCTTTTTTAGGGGGGAGGG + Intergenic
995106024 5:108379861-108379883 ATGTATTTTTTGTTGGGAGATGG - Intronic
995506354 5:112864243-112864265 ATGTTCTGTTGGAGGGGAGATGG + Intronic
995522843 5:113027208-113027230 ATGTACTTGTTGGGAGGAGGAGG - Intronic
995556401 5:113334212-113334234 ATACACTTTTTGGGGGGATAGGG + Intronic
996174980 5:120345371-120345393 AAGTACTTTTTGAGAGTAAAAGG + Intergenic
996184855 5:120463535-120463557 ATTTACATTTTGAGTGGAGTGGG - Intergenic
996722410 5:126642859-126642881 TTGTATTTTTTTAGTGGAGACGG + Intergenic
996813938 5:127552977-127552999 ATATATTATTTGAGGGGAAAAGG - Intronic
997178741 5:131805693-131805715 ATGTGCCTTTTCTGGGGAGAAGG + Intergenic
997478598 5:134165058-134165080 ATTTTTTTTTTGAGGGGGGAGGG + Intronic
998240754 5:140442211-140442233 TTGTACTTTTTTAGTAGAGACGG + Intronic
998774741 5:145586607-145586629 ATGTTCTTATTGAGGGAATAAGG - Intronic
999687309 5:154114792-154114814 AGGAACATATTGAGGGGAGATGG - Intronic
999968008 5:156830561-156830583 TTGTACTTCTTGAGCGGAGGAGG - Intergenic
1001127843 5:169036514-169036536 ATGTTCTTTATGGAGGGAGAGGG - Intronic
1001174854 5:169458740-169458762 CTGTAGTTTTTCAGGGGACAGGG + Intergenic
1001248936 5:170130798-170130820 ATATGCTTTTTGAGGGTATATGG + Intergenic
1001488584 5:172138838-172138860 TTGTACTTTTTTAGTAGAGACGG - Intronic
1001757877 5:174184931-174184953 ATGTATTTTTTTAGTAGAGATGG + Intronic
1003397287 6:5764184-5764206 ATGGAGTTATTGAGGCGAGAAGG + Intronic
1003541491 6:7022272-7022294 ATGTTCTTTTTTGTGGGAGAGGG - Intergenic
1004708547 6:18148190-18148212 ATGTACTATTTTGGGGGTGATGG + Intronic
1006768509 6:36530613-36530635 CTGTACTTTTTGAGAGGCCAAGG - Intronic
1007518803 6:42435331-42435353 TTGTATTTTTTGAGGAGACATGG + Intronic
1009031578 6:58064953-58064975 TTGTACTTTTTTAGTAGAGATGG + Intergenic
1009612801 6:65967852-65967874 TTGTACTTTTTTAGTAGAGACGG + Intergenic
1009671384 6:66756264-66756286 ATGTCCTTTTTGAGTGGGAAAGG + Intergenic
1010742260 6:79522384-79522406 ATTTAATTTTTGTGGGGAGGAGG - Intronic
1010960717 6:82142676-82142698 ATTTATTTTTTGGGGGGACAGGG - Intergenic
1011056808 6:83213535-83213557 CTGTACTTTTTTAGAAGAGAAGG + Intronic
1011395778 6:86905353-86905375 ATATACTTCTGGAGAGGAGAAGG + Intergenic
1011421325 6:87176499-87176521 ATGGCCTGTTTCAGGGGAGAAGG + Intronic
1012670310 6:102036869-102036891 ATGTACTTTTTGAAAGAAAAGGG + Intronic
1012729532 6:102864111-102864133 AAGTACTACTAGAGGGGAGAAGG + Intergenic
1013868751 6:114729782-114729804 ATGAAAATTTTGGGGGGAGATGG - Intergenic
1014118274 6:117690817-117690839 TTGTATTTTTTTAGGAGAGATGG - Intronic
1014421914 6:121256840-121256862 TTGTACTTTTTTAGTAGAGATGG + Intronic
1014915092 6:127136935-127136957 ATGAGCTTATTGTGGGGAGAAGG + Intronic
1015490262 6:133817154-133817176 TTGTACTTTTTTAGTAGAGACGG - Intergenic
1016086280 6:139919367-139919389 TTGTACTTTTAGAAGAGAGATGG + Intergenic
1016847171 6:148580006-148580028 TTGTACTTTTTTAGTAGAGATGG - Intergenic
1017511543 6:155118603-155118625 TTGTATTTTTTTAGTGGAGAAGG + Intronic
1017851052 6:158306382-158306404 TTGTACTTTTTGAAGAGACAGGG - Intronic
1017868655 6:158467451-158467473 TTGTACTTTTTTAGTAGAGATGG + Intronic
1018076798 6:160223900-160223922 TTGTACTTTTTTAGTAGAGACGG + Intronic
1018488183 6:164263664-164263686 ATCTCCTTTTTGGGAGGAGAAGG + Intergenic
1018493664 6:164324940-164324962 TTGTATTTTTTTAGTGGAGATGG + Intergenic
1018912656 6:168111933-168111955 ACATACATTTTGATGGGAGAAGG + Intergenic
1019052429 6:169193289-169193311 ATGAACTTTTTCAGGGCAGGTGG + Intergenic
1020133358 7:5572021-5572043 TTGTATTTTTTTAGTGGAGACGG + Intergenic
1020222001 7:6245995-6246017 AAGTACCTTTTTTGGGGAGAGGG - Intronic
1020239528 7:6382546-6382568 ACTTACTTTTTGAGGAGAGTAGG - Intronic
1020664712 7:11025619-11025641 TTGTATTTTTTTAGGAGAGACGG - Intronic
1020780413 7:12510355-12510377 CTGTACTTTTTGAAGAGACAGGG + Intergenic
1021812909 7:24421103-24421125 TTGTATTTTTTGAGTAGAGACGG - Intergenic
1021900314 7:25278867-25278889 ATCTACTTTTTAAGGGGTGAAGG + Intergenic
1022057303 7:26751784-26751806 AAATGCTTTTTGGGGGGAGAAGG - Intronic
1022118096 7:27279713-27279735 ATGTATTTTTTCTGGGGAGAGGG + Intergenic
1022425802 7:30267532-30267554 GGATACTATTTGAGGGGAGAAGG + Intergenic
1022491595 7:30824744-30824766 ATTTATTTTTTGTGGAGAGAGGG + Intronic
1022711748 7:32857082-32857104 ATAGTCTTTTGGAGGGGAGAGGG + Intergenic
1022912911 7:34917874-34917896 ATAGTCTTTTGGAGGGGAGAGGG - Intergenic
1026035770 7:66829623-66829645 TTGTACTTTTTGTGGAGATAGGG + Intergenic
1026172437 7:67965796-67965818 ATGGAGTTTTTGGGGGGTGATGG + Intergenic
1026486703 7:70828334-70828356 TTGTATTTTTTTAGTGGAGATGG + Intergenic
1026533039 7:71216463-71216485 CTTTGCTTTTGGAGGGGAGAGGG + Intronic
1026537019 7:71246934-71246956 ATTGACTTTTTGGGGGGAGGGGG + Intronic
1026825154 7:73577085-73577107 TTGTATTTTTTGAGTAGAGACGG - Intronic
1026862986 7:73805415-73805437 TTGTACTTTTTTAGTAGAGACGG - Intronic
1027660753 7:80985697-80985719 TTGTACTTTTTTAGTAGAGATGG + Intergenic
1027889873 7:83958523-83958545 ATGTACTATTTAAGGGCGGAAGG - Exonic
1028874578 7:95806781-95806803 AAGACCTCTTTGAGGGGAGATGG - Intronic
1030044489 7:105482740-105482762 TTCTACTTTTTGTGGGGAGAGGG + Intronic
1030886916 7:114949950-114949972 ATGGCCATTTTGAGGGGAGCTGG + Intronic
1031633555 7:124073843-124073865 ATATACTTTTTGGGGGGGGTAGG + Intergenic
1033711600 7:143951675-143951697 GTGGAGTTTTTGAGGGGAGAGGG + Intergenic
1034281457 7:149857756-149857778 ATAGATCTTTTGAGGGGAGAGGG + Intronic
1035372442 7:158388067-158388089 AAGTATTTTCTGTGGGGAGAAGG - Intronic
1036141160 8:6209950-6209972 TTGTACTTTTTTAGTAGAGAAGG - Intergenic
1036331589 8:7833577-7833599 TTGTACTTTTTAAGTAGAGATGG + Intergenic
1037516717 8:19639106-19639128 TTGTACTTTTAGAGGGGCTAGGG - Intronic
1037855461 8:22367838-22367860 ATGTACCTTCAGAGGGGAGATGG - Intronic
1038317122 8:26495193-26495215 ATGTAATATTTGAGGGTAGAGGG + Intronic
1038498131 8:28021028-28021050 ATGAGCTTTTGGGGGGGAGATGG + Intergenic
1039054711 8:33526463-33526485 ACTTCTTTTTTGAGGGGAGAGGG - Intergenic
1039152947 8:34527658-34527680 ATAGACTTTTTGAGATGAGAAGG + Intergenic
1039549673 8:38433881-38433903 AGGCATTTTTTGAGGGGCGAGGG - Intronic
1039932678 8:42008510-42008532 ATATATTTTTTGAGTAGAGACGG + Intronic
1039935134 8:42036438-42036460 TTGTATTTTTTTAGTGGAGACGG - Intronic
1039989802 8:42477776-42477798 AGGGACTTTTTAAGGGAAGAAGG + Intronic
1040494162 8:47951185-47951207 TTGTACTTTTTGAAGAGACATGG - Intronic
1041131530 8:54707294-54707316 TTGTACTTTTTGTAGAGAGAGGG + Intergenic
1041677776 8:60553025-60553047 CTGTGCTTTTTGAGAGGTGATGG + Intronic
1041788568 8:61664526-61664548 ATGTACTGGATGATGGGAGAAGG + Intronic
1042425349 8:68641640-68641662 ATTTACATTTTGACTGGAGAGGG + Intronic
1042857770 8:73285408-73285430 ATGCACTTTATGATGGGAGCTGG - Intergenic
1043411378 8:80000472-80000494 AAAAGCTTTTTGAGGGGAGACGG - Intronic
1043445394 8:80314875-80314897 TTGTATTTTTTGTAGGGAGAGGG - Intergenic
1044029456 8:87216437-87216459 AGGTGCTTTCTGAGGGGAGTGGG - Intronic
1044358905 8:91258452-91258474 ATATAGTTGTTGAGGGGACAGGG - Intronic
1044801664 8:95963485-95963507 ATCTACTTTTAAATGGGAGATGG - Intergenic
1045087875 8:98707056-98707078 AATTACTTTTTGAGGGGGAATGG - Intronic
1045740259 8:105350082-105350104 ATATACTTTTTAAGGGGTGATGG + Intronic
1046678237 8:117137027-117137049 ATGTGTTTCTTGAGGGCAGATGG + Intronic
1046922320 8:119745195-119745217 CTGGTCTTTTTGGGGGGAGAAGG + Intronic
1047403302 8:124563820-124563842 ATGTTTCTTTTGAGTGGAGATGG - Intronic
1048192040 8:132298734-132298756 TTGTACTTTTTTAGTAGAGATGG - Intronic
1049703096 8:144023870-144023892 AAGAGCTTTCTGAGGGGAGAGGG - Intronic
1049727604 8:144156534-144156556 TTGTATTTTTTTAGGAGAGATGG - Intronic
1050096189 9:2069382-2069404 TTGTATTTTTTTAGTGGAGACGG - Intronic
1050560716 9:6832164-6832186 TTGTATTTTTTTAGGAGAGACGG - Intronic
1050707543 9:8420029-8420051 ATGTACCATGTGAGGGGTGATGG - Intronic
1052274450 9:26661621-26661643 ATGGAACTTTTGAGAGGAGATGG - Intergenic
1053189937 9:36055821-36055843 TTGTTGTTGTTGAGGGGAGATGG + Intronic
1053458774 9:38252116-38252138 ATGTGCATTTTCTGGGGAGAGGG + Intergenic
1053567742 9:39270810-39270832 ATGTACTTTTTGTGTGTATATGG + Intronic
1053833753 9:42111757-42111779 ATGTACTTTTTGTGTGTATATGG + Intronic
1054129401 9:61348189-61348211 ATGTACTTTTTGTGTGTATATGG - Intergenic
1054596800 9:67075653-67075675 ATGTACTTTTTGTGTGTATATGG - Intergenic
1054888283 9:70222964-70222986 TTGTACTTTTAGAGGAGACAGGG - Intronic
1055628202 9:78195676-78195698 TTGTACTTTTTTAGTAGAGATGG - Intergenic
1055679455 9:78699975-78699997 ATTTACTTGTTGTGTGGAGAAGG + Intergenic
1056182351 9:84097648-84097670 TTGTACTTTTTGTGGAGACAGGG - Intergenic
1056198507 9:84251795-84251817 ATATACTTTTTCAGGGAAGGGGG - Intergenic
1056422736 9:86445366-86445388 ATTTTCTTTTTGTGGGGACAGGG + Intergenic
1057357190 9:94341311-94341333 TTGTACTTTTTGTGGAGACAGGG + Intergenic
1057650561 9:96916315-96916337 TTGTACTTTTTGTGGAGACAGGG - Intronic
1057912707 9:99032540-99032562 ATGGACTTTTTTTGGGGGGAGGG + Intronic
1058417733 9:104805759-104805781 ATGTGAGTTTTGAGGGGAGAAGG - Intronic
1058639619 9:107070166-107070188 ATATATTATTTTAGGGGAGACGG - Intergenic
1059983739 9:119801210-119801232 TTGTACTTTTTTAGTAGAGATGG + Intergenic
1061096086 9:128457275-128457297 ACGTCCTCTCTGAGGGGAGAAGG - Exonic
1061198116 9:129119578-129119600 TTGTACTTTTTTAGTAGAGATGG + Intronic
1061553691 9:131352729-131352751 TTGTACTTTTTTAGTAGAGATGG - Intergenic
1062227851 9:135463766-135463788 ATGTCCTTTTTAAGAGGAGGGGG + Intergenic
1203732765 Un_GL000216v2:105835-105857 CTTTACTTCTTGATGGGAGAAGG + Intergenic
1185844006 X:3420093-3420115 TTGTATTTTTTGAGTAGAGACGG + Intergenic
1185969229 X:4643312-4643334 AGGTACTTTTAGAGGGGAAGGGG + Intergenic
1186271763 X:7896398-7896420 TTGTACTTGTCAAGGGGAGATGG - Intergenic
1187449552 X:19384567-19384589 TTGTACTTTTTTAGTAGAGATGG - Intronic
1187506404 X:19881904-19881926 ATGTACTTCGTGATTGGAGAAGG + Intronic
1187703013 X:21982159-21982181 TTGTATTTTTTTAGTGGAGACGG - Intronic
1188011155 X:25057490-25057512 TTGTATTTTTTGAGTAGAGATGG + Intergenic
1188117458 X:26262986-26263008 TTGTACTTTTTTAGTAGAGACGG - Intergenic
1188405777 X:29807442-29807464 TTTTACTTTTTTAGGAGAGACGG - Intronic
1188942052 X:36251982-36252004 TGTTACTTTTTGAAGGGAGAGGG + Intronic
1189103701 X:38216041-38216063 GTGTCCTTTTTCTGGGGAGACGG - Intronic
1189372753 X:40442684-40442706 TTGTATTTTTTTAGTGGAGACGG - Intergenic
1189392066 X:40584650-40584672 TTGTATTTTTTTAGTGGAGACGG + Intronic
1189643881 X:43105247-43105269 ATCTACTTTTGGATGGGAGTTGG + Intergenic
1189881297 X:45496311-45496333 ATATACTGTTTTAGGGTAGAAGG + Intergenic
1190271329 X:48866073-48866095 TTGTACTTTTTTAGTAGAGACGG - Intergenic
1190975036 X:55390390-55390412 ATTTACTTTTGAAGGGGAGGAGG - Intergenic
1192775103 X:74236191-74236213 ATGTACTTTTTCTTGGGAGTGGG - Intergenic
1192952438 X:76031351-76031373 CTGTATTTTTTTAGTGGAGAGGG - Intergenic
1193500457 X:82267616-82267638 TTGTAATTTTTGAGGAAAGAAGG + Intergenic
1193639146 X:83990369-83990391 ATGTCCTTTTTGCAGGGACATGG + Intergenic
1193923124 X:87453945-87453967 CTTTCCTTTTTGAGGGGAGATGG - Intergenic
1194183807 X:90746315-90746337 ATGCAAGTTTTGAGGGGAGAGGG + Intergenic
1194184216 X:90752656-90752678 ATGCAAGTTTTGAGGAGAGAGGG + Intergenic
1194189263 X:90815130-90815152 ATGTGCTTTTTGTGTGTAGATGG - Intergenic
1194237631 X:91403888-91403910 GTGTACTACTAGAGGGGAGAGGG + Intergenic
1194362964 X:92977185-92977207 ATAAACTGTTTGTGGGGAGATGG - Intergenic
1194646343 X:96463268-96463290 TTGTATTTTTTTAGTGGAGATGG + Intergenic
1194769417 X:97883115-97883137 ATGGACTCTTTCAGTGGAGAGGG + Intergenic
1195090625 X:101455047-101455069 ATGGATTTTTTGAGGGAAGGAGG + Intronic
1196193795 X:112819694-112819716 ATTTATTTTTTAAGGGGAGGAGG + Intronic
1197751335 X:129965825-129965847 TTGTATTTTTTTAGTGGAGACGG + Intergenic
1198730412 X:139721985-139722007 ATGTAGGTTTTCAGAGGAGAGGG - Intergenic
1200530403 Y:4328265-4328287 ATGCAAGTTTTGAGGGGAGAGGG + Intergenic
1200530806 Y:4334579-4334601 ATGCAAGTTTTGAGGAGAGAGGG + Intergenic
1200535840 Y:4397023-4397045 ATGTGCTTTTTGTGTGTAGATGG - Intergenic
1200671206 Y:6093416-6093438 ATAAACTGTTTGTGGGGAGATGG - Intergenic
1200878484 Y:8185201-8185223 ATGTATTTATTGAGTAGAGAAGG + Intergenic
1201634808 Y:16110881-16110903 TTGTACTTTTTTAGTAGAGATGG - Intergenic
1202036206 Y:20639202-20639224 TTGTATTTTTTTAGGAGAGATGG + Intergenic
1202364186 Y:24144632-24144654 TTGTATTTTTTTAGTGGAGATGG + Intergenic
1202506594 Y:25525490-25525512 TTGTATTTTTTTAGTGGAGATGG - Intergenic