ID: 923276247 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:232399483-232399505 |
Sequence | TTCATCCCACTCTGCTCCCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 265 | |||
Summary | {0: 1, 1: 0, 2: 5, 3: 20, 4: 239} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
923276244_923276247 | -7 | Left | 923276244 | 1:232399467-232399489 | CCACACACCCTGTTCTTTCATCC | 0: 1 1: 0 2: 4 3: 25 4: 420 |
||
Right | 923276247 | 1:232399483-232399505 | TTCATCCCACTCTGCTCCCATGG | 0: 1 1: 0 2: 5 3: 20 4: 239 |
||||
923276242_923276247 | 26 | Left | 923276242 | 1:232399434-232399456 | CCTGCTGATGACAAAGGGATGGG | 0: 1 1: 0 2: 2 3: 20 4: 159 |
||
Right | 923276247 | 1:232399483-232399505 | TTCATCCCACTCTGCTCCCATGG | 0: 1 1: 0 2: 5 3: 20 4: 239 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
923276247 | Original CRISPR | TTCATCCCACTCTGCTCCCA TGG | Intronic | ||