ID: 923276247

View in Genome Browser
Species Human (GRCh38)
Location 1:232399483-232399505
Sequence TTCATCCCACTCTGCTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923276244_923276247 -7 Left 923276244 1:232399467-232399489 CCACACACCCTGTTCTTTCATCC 0: 1
1: 0
2: 4
3: 25
4: 420
Right 923276247 1:232399483-232399505 TTCATCCCACTCTGCTCCCATGG 0: 1
1: 0
2: 5
3: 20
4: 239
923276242_923276247 26 Left 923276242 1:232399434-232399456 CCTGCTGATGACAAAGGGATGGG 0: 1
1: 0
2: 2
3: 20
4: 159
Right 923276247 1:232399483-232399505 TTCATCCCACTCTGCTCCCATGG 0: 1
1: 0
2: 5
3: 20
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923276247 Original CRISPR TTCATCCCACTCTGCTCCCA TGG Intronic