ID: 923277411

View in Genome Browser
Species Human (GRCh38)
Location 1:232409667-232409689
Sequence TGGAATGGCTGAGGCCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923277411 Original CRISPR TGGAATGGCTGAGGCCTAGT GGG (reversed) Intronic
900135393 1:1115298-1115320 TGGAGTAGCCGAGGGCTAGTCGG - Intronic
906029387 1:42705694-42705716 TGCAATGGCGGAGGCCTCCTGGG + Intergenic
908981406 1:69963485-69963507 TGATATGGCAAAGGCCTAGTGGG + Intronic
911606882 1:99916596-99916618 AGGAGTGGCTGTGGCCTATTGGG + Exonic
915853255 1:159351345-159351367 TGGATTGGCTCAGGCCTACAAGG - Intergenic
923110054 1:230883163-230883185 TGGAATGGCGGAGACCTTGAGGG + Intergenic
923277411 1:232409667-232409689 TGGAATGGCTGAGGCCTAGTGGG - Intronic
1066563163 10:36692069-36692091 TGCAATGGCTGAGGGCCAGGTGG - Intergenic
1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG + Intronic
1075065919 10:119288772-119288794 TGGAGTGGCTGAGGCCGGGTGGG - Intronic
1076130409 10:128010144-128010166 TGGAAGGGCTGGGGACAAGTCGG - Intronic
1077862228 11:6192539-6192561 TGAAATAGCTGAGGCATAGGTGG - Intergenic
1080085994 11:28282807-28282829 TGGGTTGACTGAGGCCTAGTTGG - Intronic
1085871881 11:80359806-80359828 AGAAATGGCAGAGGCCTAGGAGG + Intergenic
1086945915 11:92844004-92844026 GGGAATGGCTGTGGGCTTGTGGG - Exonic
1088089678 11:106022712-106022734 AGGAATGGCTGAGGCCAATTAGG - Intergenic
1088513460 11:110600803-110600825 TGGAATGGTTGATCCCCAGTGGG - Intronic
1090878831 11:130815460-130815482 TGGGAAGGCTGAATCCTAGTGGG + Intergenic
1096228028 12:49881820-49881842 TGACATGGGTGAGGCCTAGGAGG + Intronic
1096442788 12:51659778-51659800 TGGAAAGGCTGATGACTGGTTGG + Intronic
1096541092 12:52307609-52307631 TGGAAAGGCTGAGGCCCAGAAGG - Intronic
1097768032 12:63547939-63547961 TGGAATGGCTGAGGACTGGCTGG - Intergenic
1097784393 12:63743005-63743027 TGGAATGGCTGAGGACTGGCTGG - Intergenic
1099404903 12:82247824-82247846 TGGAATGGCTGAGATAAAGTAGG - Intronic
1100390350 12:94141609-94141631 TGGAATGGCTGCCTCCTAGTTGG + Intergenic
1101586583 12:106090611-106090633 TGGAATGGCTGAGAGCTTGGGGG - Intronic
1103285799 12:119800349-119800371 TTCAATGGCTGAGGCGTAGTGGG - Intronic
1103981175 12:124737964-124737986 TGGCAAGGCTGAGGCCTGCTTGG - Intergenic
1107361709 13:39625225-39625247 GGGAATTGCTGAGGCATAGGAGG + Intergenic
1112326649 13:98446281-98446303 TGGAATGACTCAGGCCTCTTGGG + Intronic
1117288130 14:54307187-54307209 ATGAATGGCTGAGGCCCAGTGGG + Intergenic
1118815224 14:69307629-69307651 TGGAGTGGCTGTGGTCTAGCTGG + Intronic
1122977563 14:105177165-105177187 TAGGATGGCTGAGGCCCAGGCGG + Intronic
1125043580 15:35221184-35221206 GGGACTGCCTGAGGCCTAGGGGG - Intronic
1125180526 15:36877882-36877904 AGGAATGGCAGAGGCGCAGTGGG + Intergenic
1125342440 15:38688283-38688305 TGTAATGGCTGATGCCTTCTGGG - Intergenic
1125710334 15:41780112-41780134 TGAAATGAGTGAGGCCAAGTAGG - Intronic
1125756995 15:42071041-42071063 GGGACTGGCTGAGGCCTAGGAGG - Intronic
1126293841 15:47114518-47114540 TGGCAGGGCTGAAGCCTAGGTGG + Intergenic
1127160008 15:56172492-56172514 AGGAATGGATGAGACCTAGAGGG + Intronic
1128133538 15:65246337-65246359 TGGAATGGCTGAGTTCCAGCAGG - Intronic
1131943929 15:97598313-97598335 TGGCATGGCTGAGGCCAAATGGG - Intergenic
1135415964 16:22268046-22268068 TGGTTTGGCTGTGGCCCAGTGGG + Intronic
1140475597 16:75238023-75238045 CTGAAAGGATGAGGCCTAGTGGG + Intronic
1142306709 16:89290174-89290196 TGGATGGGCTGTGGCCTCGTGGG - Intronic
1144811132 17:17999543-17999565 TGCAATGGATGAGGCCTAATGGG - Intronic
1147537822 17:41332419-41332441 TGGCATGCCTGAGGCCCAGAGGG - Intergenic
1148166707 17:45489202-45489224 TGGGGAGGCTGAGGCCTAGGTGG - Intronic
1148367781 17:47069574-47069596 TGGGGAGGCTGAGGCCTAGGTGG + Intergenic
1149002503 17:51771628-51771650 TGGCAAGGCTGAGACATAGTGGG - Intronic
1150363042 17:64554556-64554578 TCAAATGGCTGAGGGCTAGCTGG - Intronic
1150397884 17:64835605-64835627 TGGGGAGGCTGAGGCCTAGGTGG - Intergenic
1150596555 17:66610824-66610846 TGAAATTGCGGAGGGCTAGTTGG + Intronic
1151619908 17:75239370-75239392 TGGAATCGATCAAGCCTAGTAGG - Exonic
1154305403 18:13227168-13227190 TGGAAGGGCTGATGCCTTGGAGG - Intronic
1157578453 18:48759246-48759268 GGGAATGGCTGTGGGCAAGTTGG - Intronic
1157978001 18:52348343-52348365 TGGAATTGCTGAGTCATAGAAGG + Intronic
1159679112 18:71325510-71325532 AGAAATGACTAAGGCCTAGTGGG + Intergenic
1160546001 18:79656143-79656165 TGGCATGGCAGAGACCAAGTTGG + Intergenic
1164863252 19:31580693-31580715 TGGAATAGCTGAGGCCTCTGTGG - Intergenic
1168663108 19:58183044-58183066 TGGAATGGGTGATGCTTGGTTGG - Exonic
925620401 2:5786751-5786773 TGGCATGGCTGAGGCCTGAGAGG + Intergenic
925714580 2:6772549-6772571 AGGAATGGATGAGTCCTAGGTGG + Intergenic
925766577 2:7242219-7242241 TGCAATGGCTAAGGCTTAATTGG + Intergenic
928172039 2:29010282-29010304 TACAATGGCAAAGGCCTAGTGGG + Intronic
928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG + Intronic
928968179 2:36997859-36997881 TAGAATGGCAGAGGACTGGTCGG - Intronic
931922956 2:67040636-67040658 TGGGATGGATGATGACTAGTGGG - Intergenic
931954554 2:67406197-67406219 TGGTATAGCTGAAGCTTAGTAGG - Intronic
932063970 2:68533669-68533691 TGGAATGGCTGGGGGCTGGCTGG + Intronic
935010021 2:99125800-99125822 GGTAATGGCAGAGGCCTAGTGGG - Intronic
940904209 2:159154096-159154118 TGGAATGGCAGAGGCTTTGGGGG + Intronic
943465966 2:188229631-188229653 GGCAATGGCTGAAGCTTAGTGGG + Intergenic
943485382 2:188473336-188473358 TGGAAGGACAGAGGCCTAGCTGG - Intronic
943808466 2:192153829-192153851 TGAGATGGCTGATGCCTACTTGG + Intronic
946331285 2:219010506-219010528 AGGAAGGCCTGAGGCCTTGTGGG - Intronic
947547049 2:231017529-231017551 TTGACTGGCTGAGGCCATGTGGG + Intronic
947763778 2:232622735-232622757 TGGAATAGCTCAGGCCCAGAAGG - Intronic
948412905 2:237778489-237778511 AGGAATGCCTGAGGCCAAGACGG - Intronic
1168753876 20:302247-302269 TGGAATGGAGGAGGCCTGATTGG - Intergenic
1169806707 20:9567115-9567137 TGGAATTGCTGAGGCCAGGATGG + Intronic
1170399021 20:15960043-15960065 TGGAATGGCTGTTGCCTCCTGGG - Intronic
1170446745 20:16436292-16436314 TGGAATGACAGAGGGCTAGGAGG + Intronic
1172931095 20:38586939-38586961 TGGAATGGCTGAGGTCTCCTAGG - Intronic
1174454575 20:50640192-50640214 TGGAGTGGCAGAGGCCCTGTGGG - Intronic
1174472222 20:50769529-50769551 TGGAGTGGCAGAGGCCCTGTGGG + Intergenic
1174830940 20:53811790-53811812 TGAAATGCCTGAGGCCTGGTAGG + Intergenic
1176920794 21:14685025-14685047 TGGAATGGCAGAGGTCTTTTGGG - Intergenic
1177160976 21:17547500-17547522 GGGAATAGCAGAGGCCTAGATGG + Intronic
1178728048 21:35072711-35072733 CAGAATGGCTGAGGCCAGGTTGG + Intronic
1179771034 21:43617022-43617044 TGGAACAGCTGGGGGCTAGTGGG - Intronic
1179976010 21:44866947-44866969 TGGAATTGCTGAGTCATAGGTGG - Intronic
1180926211 22:19556756-19556778 TGGAATTGCTGAGGACATGTCGG - Intergenic
1183214041 22:36467741-36467763 TGGAAGGGCTGAGTTCTATTGGG + Exonic
1183293668 22:37018006-37018028 TGGAAAGACTGAGGCCTACATGG + Intronic
1184864624 22:47195419-47195441 TGGAGGGGCTGAGGCCTTCTGGG - Intergenic
1184989962 22:48160771-48160793 TGGCAGGGCTGGGGCCTGGTGGG + Intergenic
1185239664 22:49735771-49735793 TGGACTGACTCAGGCCTTGTGGG - Intergenic
952648007 3:35685364-35685386 TGGATTGGCTGAGGAGTGGTGGG + Intronic
952965124 3:38616441-38616463 TGGAATGTCTGGGGCCATGTTGG + Intronic
953869416 3:46613598-46613620 GGGATTGGCTGAGGTCGAGTTGG - Intronic
954132570 3:48567969-48567991 TGGAGTAGCTGAGGCCTGTTTGG - Intronic
955348609 3:58178534-58178556 TGGAAAGACTGAGGCCCAGAGGG + Intergenic
955367646 3:58325386-58325408 TGAAATGGCTAAGGCCTAGCTGG - Intergenic
957803215 3:85113392-85113414 TAAAATGCCTGAGACCTAGTAGG + Intronic
958773157 3:98449824-98449846 AGGAAAGCCTGTGGCCTAGTTGG + Intergenic
959129236 3:102332379-102332401 TGCATTGACTCAGGCCTAGTGGG + Intronic
961354497 3:126327422-126327444 TGGAAGGGGTGAGGCCAGGTTGG + Intergenic
961545962 3:127633418-127633440 TGAAATAACTGAGGCCTAGTGGG - Intronic
961545974 3:127633555-127633577 TGAAATAACTGAGGCCTGGTGGG - Intronic
961815004 3:129544834-129544856 TGGGAAGACTGAGGCCTAGAGGG + Intronic
963601879 3:147385601-147385623 TGGAGTGTCTGAGGCACAGTTGG - Intergenic
964246239 3:154657209-154657231 TAGCATGGCTTAGGCCCAGTGGG - Intergenic
967127413 3:186436221-186436243 GGGAGAGGCAGAGGCCTAGTGGG + Intergenic
968784650 4:2611093-2611115 TGGAATTGCTGAGTCCTATAGGG + Intronic
969966898 4:11005778-11005800 TGGGATGCCTGAGGCATATTGGG + Intergenic
970056055 4:11973121-11973143 TGGATTGGCTGAGCCTTATTAGG - Intergenic
971618828 4:28828344-28828366 TGGAATGGATGGGGCGCAGTGGG - Intergenic
978679287 4:111359397-111359419 TGGACTGGCTGAGGCGAGGTGGG - Intergenic
979719073 4:123877790-123877812 TTGAATGCCTGAAGCATAGTTGG + Intergenic
980259804 4:130433564-130433586 TGGAATGTCTGTGGCCAAGAGGG - Intergenic
983902241 4:173147867-173147889 GGGAAAGGCTGAGGTCTAGGGGG - Intergenic
989456546 5:41650554-41650576 TGGAAGGACTGAGGCCTTCTGGG - Intergenic
993602139 5:89940047-89940069 AGAATTGGCTGAGGCCTTGTGGG - Intergenic
996344061 5:122471014-122471036 TGGTTTGGCTGAGGCCAAGCAGG + Intergenic
998760828 5:145429946-145429968 TGGGATGGCTGAGGGCTGGCTGG - Intergenic
999395059 5:151221989-151222011 TGGCATGGCTGGGGCCAAGAAGG + Intronic
1000908366 5:166991070-166991092 TAGAATGCCTGAGGCCTGCTTGG + Intergenic
1007172007 6:39870657-39870679 TGCAATGGTTGAGGGCTACTGGG - Intronic
1017276092 6:152570556-152570578 TGGACTTGCTGAGGCCACGTTGG + Intronic
1018617905 6:165705125-165705147 TGGAATGGGTGAAGCCTGGATGG + Intronic
1019622029 7:1997388-1997410 TGGAAAGGCTGGGGCCTAGGTGG - Intronic
1019707236 7:2502537-2502559 AGGAAAGGCTGAGGCCTCCTGGG + Intergenic
1021925190 7:25527797-25527819 TGTGATGGCTGAGGACTAGAGGG - Intergenic
1022305791 7:29145731-29145753 TGGAAAGACTGAGGTTTAGTAGG + Intronic
1022393396 7:29962736-29962758 TGAAATGGCTGAGGAATAGATGG + Intronic
1025639833 7:63355632-63355654 TGGAATGACTGAGTCCGAGAAGG - Intergenic
1025642866 7:63392460-63392482 TGGAATGACTGAGTCCGAGAAGG + Intergenic
1025712305 7:63924670-63924692 TGGAATGACTGAGTCCGAGAAGG + Intergenic
1026760401 7:73122069-73122091 AGGAATGGCTGGGGGCTGGTGGG - Intergenic
1026805680 7:73428753-73428775 TGGAATGGCTGAACTCTTGTGGG - Intergenic
1027036743 7:74930890-74930912 AGGAATGGCTGGGGGCTGGTGGG - Intergenic
1027086820 7:75270569-75270591 AGGAATGGCTGGGGGCTGGTGGG + Intergenic
1028357419 7:89926156-89926178 GGGATTGGCTGAGGCCTTGGTGG - Intergenic
1029393122 7:100288567-100288589 AGGAATGGCTGGGGGCTGGTGGG + Intergenic
1032060129 7:128717154-128717176 TGGAAGGACAGAGGCCAAGTGGG + Intronic
1032474578 7:132203297-132203319 TGGAAGGGCTGGGGCCTAGCAGG - Intronic
1035950091 8:4010495-4010517 TGGCATGGCTGAGGTAGAGTTGG - Intronic
1037815320 8:22108908-22108930 GGGAAGGAATGAGGCCTAGTCGG + Intronic
1038724857 8:30071977-30071999 TGGAATGACTGAGGCATACATGG + Intronic
1040289366 8:46116505-46116527 TGGAATGGGAGAGGCCTCCTGGG + Intergenic
1040291728 8:46128980-46129002 TGGAATGGGAGAGGCCTCCTTGG + Intergenic
1040293553 8:46137699-46137721 TGGAATGGGAGAGGCCTCCTTGG + Intergenic
1040298347 8:46174961-46174983 TGGGATGGCAGAGGCCTCTTTGG - Intergenic
1040298884 8:46177768-46177790 TGGAATGGGAGAGGCCTCCTTGG - Intergenic
1040304885 8:46206880-46206902 TGGGATGGGAGAGGCCTTGTTGG - Intergenic
1040305194 8:46208389-46208411 TGGGATGGGTGAGGCCTTCTTGG - Intergenic
1040309447 8:46229190-46229212 TGGAATGGGAGAGGCCTTCTAGG - Intergenic
1040313100 8:46246961-46246983 TGGAATGGGAGAGGCCTTCTTGG - Intergenic
1040316395 8:46263180-46263202 TGGGATGGAAGAGGCCTACTTGG - Intergenic
1040336870 8:46420542-46420564 TGGAATGGGAGAGGCCTCCTTGG - Intergenic
1040340236 8:46436787-46436809 TGGAATGGGAGAGGCCTCCTTGG + Intergenic
1040340625 8:46438714-46438736 TGGAATGGAAGAGGCCTCCTTGG + Intergenic
1040340671 8:46438930-46438952 TGGGATGAATGAGGCCTTGTTGG + Intergenic
1042126404 8:65541575-65541597 GGGCATGGATGAGGCCTAGTTGG - Intergenic
1045210969 8:100099266-100099288 TGGATTGTCTTAAGCCTAGTAGG - Intronic
1052608329 9:30733731-30733753 TGGAGTTGCTGAGGGCTATTGGG + Intergenic
1052794852 9:32914038-32914060 GGGAGTGGCAGAGGCCTGGTAGG - Intergenic
1057905229 9:98977700-98977722 TTGAATGGCTGAGGTCTAGGGGG + Intronic
1186321868 X:8436463-8436485 GGGAAAGGGTGTGGCCTAGTGGG - Intergenic
1195146404 X:102021665-102021687 TGGAATGCCTGTGGACCAGTAGG - Intergenic
1195221428 X:102747950-102747972 TGGAAAGGCTGTTGCCAAGTGGG + Intronic
1195493953 X:105508001-105508023 TGCAGTGGCTGGGGCCTAATAGG - Intronic
1195612089 X:106878996-106879018 TAGAATGGCAGAGACCAAGTGGG - Intronic
1195681595 X:107551219-107551241 TTGAAAGGCTTAGGCCTAGGTGG + Intronic
1198492266 X:137153668-137153690 TGACATTGCTGAGGCCTTGTTGG + Intergenic
1198651040 X:138864247-138864269 TGGAATAGCTGAGTCCTTGCAGG - Intronic
1198910446 X:141607377-141607399 TGGGGTGGCTGAGGCCTACAGGG - Intronic