ID: 923280600

View in Genome Browser
Species Human (GRCh38)
Location 1:232439394-232439416
Sequence CTTTGGGTCTGGCGACCTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923280600_923280605 2 Left 923280600 1:232439394-232439416 CCATCAGGTCGCCAGACCCAAAG 0: 1
1: 0
2: 1
3: 11
4: 88
Right 923280605 1:232439419-232439441 CTTGTCGTCACTGTTGCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 110
923280600_923280607 29 Left 923280600 1:232439394-232439416 CCATCAGGTCGCCAGACCCAAAG 0: 1
1: 0
2: 1
3: 11
4: 88
Right 923280607 1:232439446-232439468 GCTGGAGAGCGTGTTGCTGCTGG 0: 1
1: 1
2: 3
3: 19
4: 223
923280600_923280604 -1 Left 923280600 1:232439394-232439416 CCATCAGGTCGCCAGACCCAAAG 0: 1
1: 0
2: 1
3: 11
4: 88
Right 923280604 1:232439416-232439438 GTGCTTGTCGTCACTGTTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 79
923280600_923280606 11 Left 923280600 1:232439394-232439416 CCATCAGGTCGCCAGACCCAAAG 0: 1
1: 0
2: 1
3: 11
4: 88
Right 923280606 1:232439428-232439450 ACTGTTGCTGGAGGTGTTGCTGG 0: 1
1: 0
2: 2
3: 21
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923280600 Original CRISPR CTTTGGGTCTGGCGACCTGA TGG (reversed) Exonic
900341804 1:2193120-2193142 CCTTGTGTCTGGCGACCTCTGGG - Intronic
900432758 1:2610782-2610804 CTCTGGGGCTGGGGACCTCACGG + Intronic
904337112 1:29805171-29805193 CTCTGTGTCTGGCAGCCTGATGG + Intergenic
905175094 1:36130442-36130464 CTGTCTGTCTGGCAACCTGAAGG + Intergenic
912821319 1:112870108-112870130 GTTTGGGTCTAGAGACCTTAAGG - Intergenic
914984831 1:152447614-152447636 CTTCTGGCCTGGCTACCTGAAGG - Intergenic
917968717 1:180194159-180194181 CTGTGGGGCTGGCAGCCTGAAGG + Intronic
920695940 1:208181339-208181361 CTCAGGGTCTGGCCCCCTGAAGG - Intronic
923280600 1:232439394-232439416 CTTTGGGTCTGGCGACCTGATGG - Exonic
1063244159 10:4201421-4201443 CCTTGGCTCTGCCGTCCTGAAGG - Intergenic
1075450248 10:122546342-122546364 TTTTGGGGCTGGCCACCTGGGGG + Intergenic
1075589075 10:123678479-123678501 CTTGGGGTCAGGAGGCCTGAAGG + Intronic
1075740776 10:124694701-124694723 CTATGTGTCTGGGGCCCTGAGGG + Intronic
1076560765 10:131361855-131361877 CTTTGGGTATGTCGACCTGGAGG - Intergenic
1076772667 10:132675055-132675077 CTTTGGGTATGGAGGACTGAGGG - Intronic
1083140118 11:60714740-60714762 CTTTGGGTGTGGAGACCTGAGGG - Intronic
1085033391 11:73286136-73286158 CTCTGGGTCAGGTGACCTTAAGG + Intronic
1091852240 12:3708869-3708891 ATTTAGGTCTGGAGACTTGAAGG - Intronic
1093341898 12:17986743-17986765 CCTTGGGTCAGGCAACATGAAGG + Intergenic
1096333069 12:50731551-50731573 TTTTGGGACTGGCCACCTGCTGG - Intronic
1099930344 12:89067033-89067055 CATTGGGTTTGGCAACCTGCAGG + Intergenic
1103530157 12:121595566-121595588 CGTTGGGTCTCCCTACCTGAAGG + Intergenic
1104600613 12:130150883-130150905 ATTTGGGTCTGGGGAGCTGGGGG - Intergenic
1108117496 13:47145390-47145412 CTGTGTGTCTGGCTCCCTGATGG - Intergenic
1111740725 13:92202709-92202731 CTTAGGGTCTGAGAACCTGAAGG + Intronic
1113591727 13:111506237-111506259 CTTTGCATCTGGAGAGCTGAAGG + Intergenic
1114567835 14:23645477-23645499 GTGTGGGTCTGGGGAGCTGAAGG + Exonic
1121469905 14:94144712-94144734 CTTTGGGGCTGGCAACCTCGGGG + Intergenic
1125323700 15:38514963-38514985 ATTTGGGTCTGGGGTACTGAGGG + Intronic
1129520075 15:76180320-76180342 CTTTGTTTCTGATGACCTGAAGG + Intronic
1130402057 15:83566426-83566448 CTTTGGGCTTGGGGACCTGGAGG + Intronic
1130554491 15:84913290-84913312 CTTGGGGTCTGGAGACATGAGGG + Intronic
1131017596 15:89070903-89070925 CTTTGGCTCTGCCGTCCGGAAGG + Intergenic
1135694081 16:24572182-24572204 CTTCGGGTCTGGCTTCCAGAAGG - Exonic
1136043956 16:27601252-27601274 TCGTGGGTCTGGCGTCCTGATGG + Intronic
1139138490 16:64233460-64233482 CTTTGGGTTTGGGGGGCTGAAGG + Intergenic
1146321500 17:31850342-31850364 CTTTGGGTCTGACGGGCTCAAGG - Intergenic
1146884446 17:36461840-36461862 CTTTGTGTCTCACGACCTGAGGG + Intergenic
1149464387 17:56864185-56864207 CTCTGGGTCAGCCGACCTGTGGG - Exonic
1153588884 18:6652377-6652399 CACTGGGCCTGGCAACCTGAGGG - Intergenic
1158877384 18:61746105-61746127 CTTTGGGTCTTGGGATCTGGTGG + Intergenic
1161011805 19:1963032-1963054 CATTGAGCCTGGCGTCCTGAAGG - Intronic
1163325103 19:16598445-16598467 CTTGGGTTCTGGCGACATGATGG + Intronic
1165495237 19:36148854-36148876 CTGTGGGTATGGACACCTGAGGG + Intronic
1165794795 19:38512482-38512504 CCTTGGGTCAGGCGCCCTTACGG - Exonic
1167796407 19:51712582-51712604 CATAGGGTCTGGTGCCCTGATGG + Intergenic
926774805 2:16411520-16411542 CATTGGATCTGGCAAACTGAAGG - Intergenic
927135909 2:20096461-20096483 CTTTGTGTCTGGCAGCCTGAGGG - Intergenic
930860714 2:56070261-56070283 CTCTGGCTCTGGCTACCTAAAGG + Intergenic
933254501 2:80065215-80065237 CTGTGGCTCTGGGGACCTGGGGG + Intronic
934624118 2:95833805-95833827 CTTGGGGTCTGGCCCACTGAGGG - Intergenic
934629494 2:95901333-95901355 CTTTGTCTCTGGGGACCAGAAGG + Intronic
934629909 2:95906949-95906971 CTTTGTCTCTGGGGACCAGAAGG + Intronic
934809113 2:97266124-97266146 CTTGGGGTCTGGCGCAGTGAGGG - Intergenic
934828392 2:97491045-97491067 CTTGGGGTCTGGCGCAGTGAGGG + Intergenic
935205131 2:100890516-100890538 ATTTGGGCCTGATGACCTGAGGG - Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
939356425 2:141109097-141109119 CTGTGTTTCTGGCCACCTGATGG + Intronic
1170413483 20:16115593-16115615 CTTGGAGTCTGGCTACCTAAGGG + Intergenic
1172864541 20:38085691-38085713 CTTTGGGTCTGGAGAGATGAAGG - Intronic
1173783707 20:45776954-45776976 CTTTGGGTTGGGGGACCAGAGGG + Intronic
1182957874 22:34443978-34444000 GTTTGGCTCTGGGGATCTGAAGG - Intergenic
1183464658 22:37973544-37973566 CTGTGGGACTGGGGCCCTGAGGG + Exonic
1184709842 22:46243071-46243093 CTTTGGGTTGGGCCACCTGGAGG - Exonic
954527010 3:51280671-51280693 CTCTGGGTCTGGAGCACTGAGGG + Intronic
965419818 3:168443951-168443973 CTTTGAGTCTGGCAATCTGCTGG + Intergenic
969121476 4:4914547-4914569 CTTTGGGTCTGAAGAGATGAGGG + Intergenic
972926571 4:44015942-44015964 CTTTGGGTCTGGAGACAGGCTGG - Intergenic
984599518 4:181710381-181710403 CGTTGGATCTGGCCACATGAAGG + Intergenic
985811989 5:2097024-2097046 CCTTGGCTCTGGCCGCCTGAAGG + Intergenic
988831963 5:34996628-34996650 AATAGGGTCTGGAGACCTGAAGG - Intergenic
991280901 5:64911729-64911751 CTTTGGGTCTGGCTATCTCAAGG + Intronic
995563043 5:113403740-113403762 CCCTGGGTCTGGCTCCCTGATGG - Intronic
1001028187 5:168242008-168242030 CTTTGGGGCTGGAGACCTCCAGG - Intronic
1004231096 6:13834037-13834059 GTTTGGGTCTGGGGACTTGAGGG + Intergenic
1006257531 6:32843706-32843728 CTTTGGGTCTGGCGCTCTCCGGG + Intronic
1006425900 6:33962877-33962899 CCCTGGGTGTGGCAACCTGAGGG - Intergenic
1006797521 6:36741232-36741254 CTTTAGGTCTGACATCCTGAGGG - Exonic
1008488242 6:52058228-52058250 CTGGGAGTCTGGCGACCTGAGGG - Intronic
1010281904 6:74031953-74031975 CTTTGGTTCTGGTGATGTGATGG + Intergenic
1015366157 6:132400801-132400823 CTTTGGCTTTGGGGACCTAATGG - Intronic
1018754490 6:166837496-166837518 CTCTGTGTCTGTCCACCTGAGGG + Intronic
1032859236 7:135861851-135861873 CTTTGTGTGTGGAGACCTGAAGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1035109755 7:156471244-156471266 CTTTGATTCCGGCGACCTGGAGG - Intergenic
1037334847 8:17782011-17782033 CCTTGGGTCTGGCCAACCGAGGG - Intronic
1043448507 8:80342524-80342546 CCTTGGATTTGGCAACCTGATGG - Intergenic
1052853675 9:33393755-33393777 CTTTGGGTTTGGCAACGTGGAGG - Intronic
1053398674 9:37799222-37799244 CTTTTGGTCTGGCAGCCTCATGG + Intronic
1053426647 9:38014531-38014553 GTTTGGATCTGGGGTCCTGAGGG - Intronic
1057031997 9:91783147-91783169 CTATGGGACTGGTGACCTGTAGG - Intronic
1057911495 9:99023407-99023429 CTCTGGCTCTGGTGACCTGGTGG + Exonic
1059378750 9:113907226-113907248 CTTAGGTTGTGGGGACCTGAAGG + Intronic
1189462462 X:41253526-41253548 CTTTGGGTCTGGGCACCTAAGGG - Intergenic
1192994107 X:76493635-76493657 CTTTGAGTCTGATGACCTGTTGG - Intergenic
1195211312 X:102654009-102654031 CCTTGGGTCTGACCACCAGAGGG - Exonic
1195217461 X:102714965-102714987 CCTTGGGTCTGACCACCAGAGGG - Exonic
1195237687 X:102917873-102917895 CCTTGGCTCTGGCTACCAGAAGG - Intergenic
1196815130 X:119659424-119659446 CTTTGGGTTTGGTGATATGAAGG - Intronic
1199301521 X:146219657-146219679 CATTGGGTTTGGCAACATGAAGG - Intergenic
1200088521 X:153623628-153623650 CTCTGGCTCTGGAGAGCTGAGGG - Intergenic