ID: 923281522

View in Genome Browser
Species Human (GRCh38)
Location 1:232447524-232447546
Sequence GAAGTTCAGCCATTCTCTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923281522_923281524 -1 Left 923281522 1:232447524-232447546 CCGACAGAGAATGGCTGAACTTC 0: 1
1: 0
2: 1
3: 14
4: 151
Right 923281524 1:232447546-232447568 CAGTGGTCCCTCACCACTGAAGG 0: 1
1: 0
2: 1
3: 12
4: 118
923281522_923281525 3 Left 923281522 1:232447524-232447546 CCGACAGAGAATGGCTGAACTTC 0: 1
1: 0
2: 1
3: 14
4: 151
Right 923281525 1:232447550-232447572 GGTCCCTCACCACTGAAGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923281522 Original CRISPR GAAGTTCAGCCATTCTCTGT CGG (reversed) Intronic
902548234 1:17203835-17203857 GGAGCTTGGCCATTCTCTGTTGG - Intergenic
904509460 1:30991516-30991538 GAAGTTTAGAAATTCTATGTAGG - Intronic
906693383 1:47807935-47807957 CAAGTTCACCCCTTCTCAGTTGG - Intronic
907770312 1:57455445-57455467 GGAGTTCAGGCTTTATCTGTAGG + Intronic
909998227 1:82307801-82307823 TAAGTTCAACCATTTTCTTTTGG + Intergenic
911903929 1:103541041-103541063 GAAGTCCAGCCATTTTATTTCGG + Intronic
912080862 1:105934015-105934037 GAAGTTCACCCACTTGCTGTGGG + Intergenic
915160687 1:153917977-153917999 GGCAATCAGCCATTCTCTGTGGG + Intronic
915652435 1:157325875-157325897 GGAGTTCAGGGATTCTCTGGAGG - Intergenic
920100996 1:203516962-203516984 GAACAGCAGCCATTCTCTCTGGG + Intergenic
923281522 1:232447524-232447546 GAAGTTCAGCCATTCTCTGTCGG - Intronic
1063984265 10:11484432-11484454 CAAGTTCAGCCAGTGTCTATAGG - Intronic
1065228912 10:23576802-23576824 GAAATTTATCCATTCTCTTTAGG + Intergenic
1067066636 10:43107467-43107489 GTAGTTCTGCCATGCTCTGGGGG + Intronic
1067537897 10:47128657-47128679 GAACTTCAGCCATTCTTTACAGG - Intergenic
1071365071 10:84891153-84891175 GAAGTTTGGCCTGTCTCTGTTGG + Intergenic
1072050407 10:91698449-91698471 GGAGCTAAGCCATCCTCTGTTGG - Intergenic
1076981980 11:209400-209422 GCAGCTCCGCCAGTCTCTGTGGG - Exonic
1077469800 11:2751887-2751909 GAAGGTCAGCCATGCTATGGGGG - Intronic
1077718138 11:4601360-4601382 GAAGTGCACACATTTTCTGTCGG + Intronic
1081896869 11:46594207-46594229 GCACTTCTGCCATTTTCTGTGGG + Intergenic
1083347374 11:62003036-62003058 GATGTTCAGTCATTATCTATTGG + Intergenic
1083678788 11:64341987-64342009 GCAGTTCAGCCAGCCGCTGTAGG - Exonic
1083814391 11:65124440-65124462 GAAGTTATGCCATCCTGTGTTGG + Intronic
1085152959 11:74266960-74266982 GGAGTTCAGATACTCTCTGTTGG - Exonic
1088914285 11:114215829-114215851 AAAATTCAGGCATTCTCTGATGG + Intronic
1089735197 11:120546104-120546126 GAGGTACAGCCGTTCTCTGTAGG + Intronic
1090367836 11:126222769-126222791 GAAGTTCAAACATTCGCTGATGG - Intronic
1090602990 11:128391824-128391846 GAGTTTCAGCCATATTCTGTCGG - Intergenic
1090603068 11:128392519-128392541 AAATTTCAGCCACACTCTGTGGG + Intergenic
1091010469 11:131996464-131996486 AAATTTCAGCTCTTCTCTGTAGG + Intronic
1092096740 12:5849100-5849122 GAAGTTCTGGCATGCTCTGAGGG + Intronic
1094404967 12:30107682-30107704 GAAGTGTAGCCATTTTTTGTGGG - Intergenic
1096175937 12:49519089-49519111 GAAGTTCAGCCTTCTTTTGTCGG - Exonic
1097269946 12:57767751-57767773 TAAGTTCAGAGATTGTCTGTGGG + Intronic
1099226459 12:79975628-79975650 ATAGTTCATCCATTCTCAGTAGG - Intergenic
1100445030 12:94651853-94651875 GAAGTTCAGCCTTATTCTGTGGG + Intergenic
1100447187 12:94671783-94671805 AAAGTTCTGCCTTTGTCTGTGGG + Intergenic
1106620314 13:31365615-31365637 GGAGATGAGCCATTCTCTCTAGG + Intergenic
1110898083 13:80782534-80782556 GAAGTTCAGCCAAGCTCCTTGGG - Intergenic
1111415435 13:87935970-87935992 TAAATTCAACAATTCTCTGTAGG + Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1113455070 13:110442633-110442655 GAAGTTCTGACAATCTCAGTGGG - Intronic
1114451270 14:22827567-22827589 GAAGATCAGGGATTCTCTGGAGG + Intronic
1114940745 14:27607219-27607241 GAAGATCAGGAATTCTCTGGGGG - Intergenic
1115512208 14:34148607-34148629 GAGGTTCAGCTATTCTCAGTGGG - Intronic
1115862587 14:37705088-37705110 GAAGGTCAGCCAATGTTTGTAGG - Intronic
1116403935 14:44545041-44545063 GAAATTCATGCATTCTCTGAGGG - Intergenic
1119241289 14:73061961-73061983 GGAGTTTTGCCCTTCTCTGTTGG + Intronic
1120555248 14:85921530-85921552 GAACATTAGCCATTCTCTGAAGG + Intergenic
1202857055 14_GL000225v1_random:58236-58258 CAAGGCCAGCCATTCTCTGGTGG - Intergenic
1123919609 15:25061107-25061129 GAAAAGCAGCCATTCTCTTTGGG + Intergenic
1126264641 15:46739362-46739384 GAAGTTCAGGCATTCTGTGTGGG - Intergenic
1126793957 15:52244843-52244865 GAACTTCAGCCACTCTCTCGTGG + Intronic
1130287805 15:82570355-82570377 GTGGTACAGCCATTCGCTGTTGG - Intronic
1133397649 16:5461193-5461215 GAGATGCAGCCATTCTCTGCTGG - Intergenic
1135065757 16:19308334-19308356 GAGGTTAAGGCATTCTCTTTGGG - Intronic
1137073513 16:35932010-35932032 AATGTTCAGCTTTTCTCTGTTGG + Intergenic
1137499899 16:49002845-49002867 GAAGTTCATCTCTTCTCTGCTGG + Intergenic
1142346340 16:89556459-89556481 GAATTTCTGCCATTCTAGGTGGG - Intronic
1145365523 17:22262545-22262567 GATGTTCAACTTTTCTCTGTAGG + Intergenic
1146105799 17:30035269-30035291 GAAGGACAACTATTCTCTGTTGG + Intronic
1146262886 17:31433304-31433326 CAAGTTTAGCCCTTTTCTGTGGG + Intronic
1203167807 17_GL000205v2_random:114123-114145 GAAATGCATCCACTCTCTGTAGG - Intergenic
1153546267 18:6208616-6208638 GAAGTTTAGCCATTATTTGTGGG - Intronic
1154065082 18:11100150-11100172 GAAGTTGTGCAATGCTCTGTAGG + Intronic
1157728534 18:49984087-49984109 GAAGGTAAGCCTTTCTCAGTTGG - Intronic
1157868680 18:51209319-51209341 GGATTTCAGCCTTACTCTGTGGG + Intronic
1159379417 18:67637154-67637176 GATGGTCAGCCAGCCTCTGTCGG + Intergenic
1159920581 18:74223993-74224015 TAAAATCAGCCATTCTCTGATGG + Intergenic
1161294519 19:3512993-3513015 GATGTCCAGCCATCCTCTGCGGG - Intronic
1161497063 19:4592446-4592468 GAAGGGCAGCGATTCTCTGGGGG + Intergenic
1163798359 19:19349883-19349905 CAAGGTCAGCCAGTCTCTGGTGG + Intronic
924973180 2:149997-150019 GGATTTCAGCCATTCACTGGTGG + Intergenic
925845782 2:8031960-8031982 GCAGAACAGCCATTCTCTGCAGG + Intergenic
926373863 2:12207170-12207192 GAAGTTCAGTCATTACATGTTGG + Intergenic
926583924 2:14664193-14664215 GAAGTACACGCATTCTCTGTTGG - Intergenic
931793006 2:65682134-65682156 GAAGTTGTGCATTTCTCTGTTGG + Intergenic
932103318 2:68920781-68920803 GTAGTTCAGCCTGTCTCTTTTGG + Intergenic
935724460 2:106010954-106010976 GAAGTTCTGCCATTTGCAGTGGG + Intergenic
936050176 2:109216604-109216626 GATGGCCAGCCATGCTCTGTAGG + Intronic
936858939 2:116993035-116993057 GAAGTACAGCCATCTTCTGCAGG - Intergenic
940357573 2:152762251-152762273 GTAGTTCAGCCAGGCTCAGTGGG + Intergenic
943325878 2:186497563-186497585 GAAGTGCAGTTATTCTTTGTTGG + Intronic
944962032 2:204886005-204886027 GCAATTCAGCTATTCTCTGCAGG - Intronic
945814440 2:214586987-214587009 GAAGCTCAGCCATTCTTGTTGGG - Intergenic
1176403950 21:6345013-6345035 GAAATGCATCCACTCTCTGTAGG + Intergenic
1176433207 21:6644091-6644113 GAAATGCATCCACTCTCTGTAGG - Intergenic
1178455120 21:32741964-32741986 GAGGTTCAGCCTTGCTGTGTAGG - Intronic
1182833462 22:33322547-33322569 GATGTTCAGCAAGCCTCTGTTGG + Intronic
1183773677 22:39948375-39948397 GAAGTTCCTGCCTTCTCTGTGGG + Intronic
1184326749 22:43793656-43793678 GAAATTCAGCATTGCTCTGTGGG + Intronic
1184549918 22:45199050-45199072 GAAGTTCTGCCATGCTCTGCTGG - Intronic
1185405430 22:50645633-50645655 GAAGCTCAGGGATTCTCTGGAGG - Intergenic
949393169 3:3585636-3585658 TAAGTGCACCAATTCTCTGTTGG - Intergenic
951631211 3:24722732-24722754 GAAGTTTAGGCGTTCACTGTTGG + Intergenic
952827520 3:37536728-37536750 GAAATACAGACTTTCTCTGTAGG + Intronic
959771587 3:110105425-110105447 GTAGTTTAGTCATTCTCTCTTGG + Intergenic
965967185 3:174507298-174507320 GAAGTTTAGGTATTCTATGTTGG + Intronic
966219662 3:177538247-177538269 GAAGTACAGCCCTTTTCTGCTGG + Intergenic
966374150 3:179278329-179278351 GAAGTTCAAACATTCTCATTTGG - Intergenic
967971276 3:195001499-195001521 GAATTTCAGCCTTACTCTGTGGG - Intergenic
969097788 4:4747065-4747087 GAAGTTCAACCAATCCCTGTTGG + Intergenic
970215170 4:13751413-13751435 CAAGTTCAGGCATTCGCTGGGGG + Intergenic
970336076 4:15044294-15044316 GAAGACCAGACATTTTCTGTTGG - Intronic
971791798 4:31179160-31179182 GAGGTTCTGAAATTCTCTGTGGG + Intergenic
973857850 4:55031358-55031380 GAAGAACAGCTGTTCTCTGTTGG - Intergenic
974956511 4:68647788-68647810 TCAGTTCAGCCTTTCTCTTTCGG + Intronic
976003978 4:80406299-80406321 GAAGTTCTGCATTTCTTTGTGGG + Intronic
978558772 4:110009601-110009623 CAATTTGACCCATTCTCTGTGGG + Intronic
980291617 4:130852570-130852592 AAAGTTCAGTCTTTTTCTGTGGG - Intergenic
982044043 4:151424139-151424161 GAAGGTCAGACATTCTTTCTGGG - Intronic
984603761 4:181760024-181760046 GAAGTGCATATATTCTCTGTAGG - Intergenic
985716082 5:1462588-1462610 GAAGGTCAGCCATACTCGGGTGG + Exonic
985892398 5:2725742-2725764 CCTGTTCAGCCATTCTCTGGTGG + Intergenic
987254986 5:16141519-16141541 AAAGCTCAGCCATCTTCTGTTGG + Intronic
987291301 5:16511116-16511138 GAAGTTGAGCCATCCTAAGTTGG - Intronic
987679472 5:21116922-21116944 GGAGATCAGGCATTCTCTGGAGG + Intergenic
988771735 5:34439499-34439521 GTAGTCCAGCCTTTCTCTTTGGG - Intergenic
990860691 5:60323529-60323551 TAACTTCAGCAATTCTCTGCTGG + Intronic
994280204 5:97892909-97892931 CAAGTTCACCCACTCTCTGGAGG - Intergenic
994727546 5:103454215-103454237 GAAAGTCAGCCTTTATCTGTGGG - Intergenic
995496795 5:112754116-112754138 TAAGGTCATCCATTCTCTTTAGG + Intronic
1003912003 6:10751483-10751505 GAAAGTCATCCATCCTCTGTGGG + Intronic
1004883297 6:20029171-20029193 TAAGGTCAGCCATTCAGTGTGGG - Intergenic
1005182135 6:23117954-23117976 GCAGTTCATCCTTTCTCCGTTGG - Intergenic
1005376941 6:25192645-25192667 GAAATTCAGCCCCTCCCTGTTGG + Intergenic
1005578163 6:27209259-27209281 AAAGTTTTGCCATCCTCTGTGGG + Intergenic
1005948159 6:30610237-30610259 GAAGTTCAGCCATCCTAGGAAGG - Intronic
1006986360 6:38178328-38178350 GATGTTCATCCTGTCTCTGTTGG - Intronic
1008877061 6:56340616-56340638 TAAATTCAGAGATTCTCTGTTGG + Intronic
1009631462 6:66206645-66206667 GAAGTTGAGGCAGTCTCTGAAGG - Intergenic
1009743466 6:67779899-67779921 GAAGTTCAGCTACTCTCAGCTGG + Intergenic
1011404855 6:87008592-87008614 CAAAAGCAGCCATTCTCTGTGGG + Intronic
1015023573 6:128506370-128506392 GAAGGTAAGCAATTCTTTGTAGG + Intronic
1016646024 6:146409300-146409322 GGAATTCAGTCATTCTCTTTGGG - Intronic
1016663913 6:146612187-146612209 GAAATCAAGCCATTCTCTGATGG + Intronic
1016852437 6:148634862-148634884 GAAGTTCAGTGACTCTCTTTTGG + Intergenic
1018056842 6:160059499-160059521 CAATTTCAGGCATTCACTGTGGG + Intronic
1018348459 6:162928260-162928282 GAAATTCATCCATTTTCTCTAGG + Intronic
1018881455 6:167886380-167886402 AGAGTTCTGCCATACTCTGTGGG + Intronic
1018910848 6:168100314-168100336 GAACTTCAGCCCTCCTCTGTGGG - Intergenic
1020741439 7:12024221-12024243 GAAAATAAGCTATTCTCTGTAGG - Intergenic
1021121651 7:16802363-16802385 GTAGTTCCCCCATTATCTGTGGG - Intronic
1035367474 7:158358329-158358351 GAAGCTCAGCCATTCTCAGAAGG + Intronic
1036988758 8:13567672-13567694 GATGTTCATCTATTCTCTCTTGG - Exonic
1038414655 8:27385553-27385575 GAAGCTCAGCCCCTCTCTGTGGG + Intronic
1038934037 8:32228373-32228395 GAAGTTCAACCTATCTCAGTGGG - Intronic
1039648563 8:39314870-39314892 GAAGTTAAACGATTTTCTGTCGG - Intergenic
1048569172 8:135636784-135636806 GAAGCTCAGCCTCTCTTTGTGGG - Intronic
1050431015 9:5561868-5561890 TTAGTGCTGCCATTCTCTGTGGG - Intronic
1051219977 9:14837676-14837698 AAAGTTCAGAAATTCTCTGTGGG - Intronic
1052112702 9:24608400-24608422 GAAATACAGCCATTCTCTATAGG - Intergenic
1054727019 9:68662949-68662971 GAAATTCAGATATTCACTGTGGG - Intergenic
1055208608 9:73762716-73762738 GTAGAGCAGCCATGCTCTGTGGG - Intergenic
1055257584 9:74389850-74389872 GAAGTTAGGCAATTCTATGTAGG - Intergenic
1056255105 9:84790719-84790741 GAAGTGTAGCCTTTCTTTGTGGG + Intronic
1057112936 9:92491465-92491487 GCAGTTGAGCCAATCTCTGATGG - Intronic
1058250347 9:102687165-102687187 CAAGTTCAGGCATTCACTGGGGG + Intergenic
1059322271 9:113479136-113479158 CAAGTACTGTCATTCTCTGTTGG - Intronic
1203438328 Un_GL000195v1:164579-164601 GAAATGCATCCACTCTCTGTAGG + Intergenic
1191041262 X:56083086-56083108 AAATTTCAGCCATTTTCTTTAGG + Intergenic
1192354566 X:70388572-70388594 GAATTTTAGCTATTCTGTGTGGG + Intronic
1192993683 X:76489307-76489329 GAAATTCATCCATCCTCTCTAGG + Intergenic
1193624377 X:83798504-83798526 GAAGTTCATCCATTTTCTAAAGG - Intergenic
1194502307 X:94696814-94696836 GAAGATCAGGAATTCTCTGGAGG - Intergenic
1197374267 X:125663337-125663359 GATGTTCAGCCACCCTGTGTAGG - Intergenic