ID: 923282513

View in Genome Browser
Species Human (GRCh38)
Location 1:232457903-232457925
Sequence CAGGGCACCCAGACAGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923282512_923282513 -9 Left 923282512 1:232457889-232457911 CCAAATACTTTTATCAGGGCACC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 923282513 1:232457903-232457925 CAGGGCACCCAGACAGTTGCAGG 0: 1
1: 0
2: 4
3: 21
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923282513 Original CRISPR CAGGGCACCCAGACAGTTGC AGG Intronic
900546093 1:3230065-3230087 CAGGGATCCCAGAGAGCTGCAGG - Intronic
902409439 1:16204612-16204634 CAGGGCACCCTGAGATTTGGAGG - Intronic
904011843 1:27394319-27394341 CAGGCCATCCAGGCAGTTCCAGG - Exonic
908759202 1:67496434-67496456 CAGGGCACCCAGACACCCCCAGG - Intergenic
913329298 1:117653942-117653964 AAGGTCACACAGCCAGTTGCTGG - Intergenic
916108676 1:161448016-161448038 CACGGCGCCCAGAGAGCTGCCGG - Intergenic
916110264 1:161455397-161455419 CACGGCGCCCAGAGAGCTGCCGG - Intergenic
916111849 1:161462807-161462829 CACGGCGCCCAGAGAGCTGCCGG - Intergenic
916113436 1:161470188-161470210 CACGGCGCCCAGAGAGCTGCCGG - Intergenic
916724354 1:167509614-167509636 CTCGGCACCCAGATAGTTTCAGG - Intronic
920401433 1:205679162-205679184 CAGGGCAGCAAGACAGCAGCTGG + Intronic
922979924 1:229816985-229817007 CAGGGCACCCAGCTGGTTGTTGG - Intergenic
923282513 1:232457903-232457925 CAGGGCACCCAGACAGTTGCAGG + Intronic
923471918 1:234298929-234298951 GAGGGCAGCCATACATTTGCTGG + Intronic
923834357 1:237593512-237593534 CAGCCCACCCAGACATTAGCAGG - Exonic
923961779 1:239093270-239093292 CACTGCACCCAGACACTGGCAGG + Intergenic
1064571800 10:16701468-16701490 AAGGCCAAGCAGACAGTTGCCGG - Intronic
1065571254 10:27072783-27072805 CTGGGCACATAGACAGTTGCAGG - Intronic
1068370669 10:56109661-56109683 AAGGGCACACTGACAGATGCCGG + Intergenic
1070617194 10:77978180-77978202 CAGGGCACCTATAGAGTTACAGG + Intronic
1074769741 10:116725473-116725495 CAGGGCCCCCAGCCTGTTGGGGG - Intronic
1075340703 10:121644940-121644962 CAGATCACCCTGGCAGTTGCAGG - Intergenic
1075880127 10:125843874-125843896 CAGGGAACCCAGACATCCGCTGG + Intronic
1076993393 11:287374-287396 CAGGGAACCCAGGCAGGTGCAGG + Intergenic
1076993421 11:287496-287518 CAGGGAACCCAGGCAGGTGCAGG + Intergenic
1076993451 11:287618-287640 CAGGGAACCCAGGAAGGTGCAGG + Intergenic
1076993480 11:287740-287762 CAGGGAACCAAGGCAGGTGCAGG + Intergenic
1076993508 11:287862-287884 CAGGGAACCCAGGCAGTTGCAGG + Intergenic
1077296416 11:1828363-1828385 TAGGACACCCAGTCAGCTGCCGG + Intronic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079244036 11:18740339-18740361 CAGAGCACCCAGCCAGGTGATGG - Intronic
1080777917 11:35403479-35403501 CAGGGCAGCCACACATGTGCAGG - Intronic
1084188962 11:67490312-67490334 CAGGGGACCCAGGCTGTTCCTGG - Exonic
1084342447 11:68515104-68515126 CTGGGCCCCCAGCCTGTTGCTGG - Intronic
1084460844 11:69295787-69295809 AAGGGTGCCCAGACAGGTGCGGG + Exonic
1085196489 11:74675244-74675266 CACGGCACCCAGCCATTTGAGGG + Intergenic
1087684307 11:101245767-101245789 CAGGGCACCCAGACCAGTTCCGG + Intergenic
1088129200 11:106466556-106466578 AAGGTCACCCAGCTAGTTGCAGG + Intergenic
1089001435 11:115055337-115055359 CTGGGCCCCCAGCCAGTGGCTGG + Intergenic
1089362968 11:117903399-117903421 CAGGCCAGGCAGGCAGTTGCTGG - Intronic
1090977577 11:131690421-131690443 CAGCGCACCTAGTCAGTTCCCGG + Intronic
1092242904 12:6846409-6846431 GAGGGCACCTTGACAGGTGCTGG - Intronic
1094694831 12:32808151-32808173 CAGGTACCCCAGTCAGTTGCAGG + Intronic
1096464307 12:51839794-51839816 CAGGGCTCACAGACAGGGGCTGG - Intergenic
1100201102 12:92298706-92298728 AAGGTCACCCAGACACTTGTTGG - Intergenic
1100210986 12:92398457-92398479 CATGGCACCCACACATTGGCAGG + Intergenic
1101622435 12:106401959-106401981 CAGGGCAATCAGGCAGTTGAAGG + Intronic
1102048470 12:109845236-109845258 CAGGGCCCCAAGACACCTGCTGG + Intergenic
1103074363 12:117969806-117969828 CAGGCCACACAGACACTTGTAGG - Intergenic
1103159436 12:118716131-118716153 CAGTGGCCCCAGACAGTTGGAGG - Intergenic
1106182936 13:27383765-27383787 AAGAGCACTCAGACAGATGCTGG + Intergenic
1106246303 13:27953561-27953583 CCGGGGACCCAGAAAATTGCTGG + Intergenic
1106559044 13:30833151-30833173 AGGGGCACCCAGACCCTTGCAGG - Intergenic
1107963571 13:45579648-45579670 AAGAGCATCCAGAGAGTTGCTGG - Intronic
1108490614 13:50977614-50977636 TAGGGCCCCCAGATAGCTGCTGG - Intergenic
1112182962 13:97103458-97103480 CAGAGCACCCAGACAGGGCCAGG - Intergenic
1112397151 13:99043543-99043565 CAGAGGACTCAGACACTTGCAGG + Intronic
1112466677 13:99651245-99651267 CTTGGCACCAAGACAGATGCTGG - Intronic
1113386497 13:109853388-109853410 CGGGGCAGACAGGCAGTTGCTGG - Intergenic
1114482961 14:23046837-23046859 CAGAGGACCCAGAAAGTTGGTGG + Intergenic
1119482365 14:74966090-74966112 CAGGTCACCCAGCCAGTAGGTGG + Intergenic
1121278056 14:92680998-92681020 CAGGTGACCCAGGCAGCTGCTGG + Intronic
1121694892 14:95904464-95904486 CAAGGCAACCAGGCAGGTGCAGG + Intergenic
1122007292 14:98716044-98716066 CTGGGCCCCCAGCCTGTTGCAGG - Intronic
1125970454 15:43907132-43907154 AAGGGCACCCACAGAGTAGCTGG - Intronic
1126855944 15:52839528-52839550 GAGGTCACACAGACAGTTGTGGG + Intergenic
1127817354 15:62622947-62622969 CAGGGCACACAGACAGATGATGG - Intronic
1131013623 15:89039783-89039805 CATGGCACCCGGCCAGTTTCAGG + Intergenic
1131462295 15:92626383-92626405 CACCGCACCCAGCCAGTTGCTGG + Intronic
1131511640 15:93052347-93052369 CAGGTCACCCCGGCAGGTGCGGG + Exonic
1132081235 15:98867620-98867642 CAAGGCACACAGTCAGATGCAGG - Intronic
1132958961 16:2611796-2611818 CAGGGCACCCAACCTGTGGCAGG - Intergenic
1132972020 16:2693771-2693793 CAGGGCACCCAACCTGTGGCAGG - Intronic
1133146752 16:3792963-3792985 CAGGCCACCAAGACAGATGTTGG + Intronic
1133348855 16:5088587-5088609 CAGCACACCCTCACAGTTGCTGG + Intronic
1136407266 16:30055224-30055246 CCGGGCCCCCAGACTGCTGCTGG + Exonic
1136520414 16:30792086-30792108 CAGGACACCCAGACTCTTCCTGG - Intergenic
1136626645 16:31465917-31465939 CAGGGCTCCCAGAGAGCAGCAGG - Exonic
1137775495 16:51050832-51050854 CAGGCCACCCAGCCAGTTAATGG - Intergenic
1138196810 16:55058129-55058151 CAGGGCACCCAGAGTGGAGCAGG + Intergenic
1139140841 16:64260694-64260716 CAGTACAGCCAGCCAGTTGCTGG + Intergenic
1140106802 16:71968096-71968118 CAGGGCTGCCAGACACCTGCCGG - Intronic
1140599969 16:76464047-76464069 CAGGCCACCCTAACAGTTCCAGG + Intronic
1141297797 16:82785945-82785967 CAGGGGAACCACACAGTAGCAGG - Intronic
1141828395 16:86496464-86496486 CAGGGCAGCCAGGCTGATGCGGG - Intergenic
1142030287 16:87835173-87835195 CAGGGCACCCTGGGAGATGCAGG + Intronic
1142477681 17:199238-199260 CTGGGAACTCAGCCAGTTGCTGG + Intergenic
1143589572 17:7874074-7874096 GAGGGCACCAAGACAGTGGCAGG + Intronic
1143723939 17:8832778-8832800 CCAGGCACCCAGACAGAGGCAGG + Intronic
1144517083 17:15926202-15926224 CCAGGCACCCTGCCAGTTGCTGG + Intergenic
1145812781 17:27774520-27774542 CAGGGCTCCCAGAGAGTGCCTGG + Intronic
1145941386 17:28744981-28745003 CAGGGCGCCCAGAAACTTGATGG - Intronic
1146891746 17:36510819-36510841 CAGGGCAGGCAGACAGCAGCAGG - Exonic
1148690442 17:49524030-49524052 CAGGGCGCCCAGCCTGTTTCTGG - Intergenic
1150277410 17:63908794-63908816 CAGGACATCCAGACTGTTACGGG - Intergenic
1153804033 18:8696352-8696374 CAGGGCTCCCAGATAGTATCAGG - Intergenic
1154064506 18:11094476-11094498 CAGGAGACTCAGACAGTTGTAGG + Intronic
1155119814 18:22806904-22806926 CAGGGCACCCAGACCCTGTCTGG - Intronic
1157600535 18:48890475-48890497 CAGGGCACTGAGACATTTGTGGG + Intergenic
1160152129 18:76403261-76403283 CAGGTCAGGCAGACAGGTGCAGG - Intronic
1162059458 19:8085954-8085976 GAGGGCTCCCAGACAGTGGGAGG + Intronic
1163054268 19:14706460-14706482 GAGGGCACCCAGGCAGGGGCTGG - Intronic
1163309443 19:16504469-16504491 CAGGGCAGCCAGCCAGCTGGGGG - Intronic
1163554720 19:17985335-17985357 CATGGCCCCCAGGAAGTTGCTGG - Exonic
1163574721 19:18103921-18103943 CACTGCACCCAGCCAGTTGTGGG - Intronic
1163631567 19:18420236-18420258 CAGGGGCCCCACACAGCTGCTGG - Intronic
1163672517 19:18637162-18637184 CTGGGCTCCAAGACAGGTGCAGG - Intronic
1164596917 19:29536223-29536245 CAGGGCACCCAGGTAATTCCAGG + Intronic
1165792158 19:38499163-38499185 AAGGGTACCCAGACATTGGCTGG + Exonic
1166079440 19:40434373-40434395 CAGGGCAGGCAGAGAGCTGCAGG + Intergenic
1167353651 19:48991143-48991165 TAGGACACCCAGACAGATGCAGG - Intronic
1167718330 19:51158931-51158953 CTGCTCACCCAGAGAGTTGCAGG - Intergenic
1168407550 19:56118843-56118865 CAGGGCAGCCAGGCAGTTGCTGG + Intronic
1168720174 19:58550517-58550539 CAGGGCCACCAGACAGCTCCTGG - Exonic
927520086 2:23693284-23693306 CAGCACGCCCAGGCAGTTGCTGG - Exonic
927879849 2:26682594-26682616 CAGGGCACCCAGTGATTTGAAGG - Intergenic
931634662 2:64330519-64330541 GAGGGCAGCCAGACAGTGGCAGG + Intergenic
935304030 2:101719489-101719511 CAGCAGACCCAGACAGTGGCAGG + Intronic
937989382 2:127653901-127653923 CAGGGCTCACAGACAGAGGCCGG + Intronic
941761291 2:169246891-169246913 AAGGGCACCCACACACTCGCTGG + Exonic
946976846 2:225162722-225162744 CAGGGAACCCAGTCAGTGGAAGG - Intergenic
947463915 2:230324912-230324934 CAGGGCACCCATCCAGGTGATGG - Intergenic
947472825 2:230414059-230414081 CAGGGCACCCAGCCAGATGATGG - Intergenic
948894122 2:240920427-240920449 CAGGGCTCCCGGGCAGGTGCGGG - Intronic
1170462999 20:16596753-16596775 CAGGGCCACCAGACAGCTCCTGG - Intergenic
1172763888 20:37340650-37340672 AAGGTCACACAGAGAGTTGCTGG - Intergenic
1173858229 20:46265007-46265029 CAGGGCAGGGAGACAGGTGCAGG - Intronic
1174031944 20:47635942-47635964 CAGGGCACTGAGAGAGCTGCTGG - Exonic
1175369743 20:58480279-58480301 CAGTGCACTCAGAGAGTTGAAGG + Intronic
1175799266 20:61791932-61791954 CAGGGCCCCCAGCCAGTAGGAGG + Intronic
1176002553 20:62839572-62839594 CAGGGCACCCAGGCAGAGGTGGG - Intronic
1177339497 21:19781924-19781946 GAGGGCACACACACAGTGGCTGG + Intergenic
1181952261 22:26563098-26563120 CAGTGAACCCAGTCAGTTTCAGG - Intronic
1182430355 22:30295398-30295420 AAGGGGACCAAGACAGATGCAGG - Intronic
1183323456 22:37178782-37178804 CAAGTCCCCCAGACAGTTCCAGG - Intergenic
1183508670 22:38222826-38222848 CAGGGCACCCAGGAAGCTCCAGG + Intronic
1183972201 22:41485990-41486012 GAGGGCAACCAGGCATTTGCAGG - Intronic
1184350863 22:43943362-43943384 CAGAGCTCCCAGACAGTGACAGG + Intronic
1184767658 22:46579966-46579988 CAGGCCACCCAGCCAGTCCCTGG - Intronic
1185127481 22:49019373-49019395 CAGGGCACCCAGATGGCTGGTGG + Intergenic
950520349 3:13494523-13494545 CAGCACAGCCAGACAGCTGCAGG - Intronic
950639597 3:14340243-14340265 CAGGTCACCCAGACAGTGAGTGG + Intergenic
951405888 3:22296856-22296878 CATGGCACCATGCCAGTTGCTGG - Intronic
954296679 3:49678207-49678229 CAGGCCACCCGGTCAGTTCCAGG + Intronic
956795766 3:72717101-72717123 TATGGCACCCAGACGGTTTCAGG - Intergenic
962474371 3:135742436-135742458 GAGGTCACCCAGACACTTGAAGG - Intergenic
962962951 3:140328184-140328206 CAGGGCAGACAGACACTTTCAGG + Intronic
964727213 3:159825911-159825933 GAGGGCCCTGAGACAGTTGCAGG + Intronic
965743536 3:171901529-171901551 GGGGGCACCCAGGCAGTGGCAGG + Intronic
968440381 4:621004-621026 CAGGGCACCCACACATGTGAGGG + Intergenic
969637512 4:8377903-8377925 CACGGCACCCAGACACATCCGGG + Intronic
969700471 4:8765017-8765039 TTGGGCACACAGACAGTTGCTGG - Intergenic
970174935 4:13330223-13330245 CAGGGTGACCAGCCAGTTGCGGG + Intergenic
976182349 4:82410818-82410840 CACTGCACCCAGCCAGTTGTGGG + Intergenic
978172266 4:105687653-105687675 CACTGCACCCAGCCAGTTGCTGG - Intronic
980652260 4:135733364-135733386 CAGCGCACTCACACAGTTGCTGG + Intergenic
981752868 4:148109304-148109326 CAGGGCAGCCAGACAGCACCTGG - Intronic
983266636 4:165514340-165514362 CACGGCACCCTGCCAGGTGCTGG - Intergenic
985550786 5:532567-532589 CAGGTCACTCTGACAGTTTCAGG - Intergenic
986757727 5:10853774-10853796 CAGGCCACCCAATCTGTTGCAGG + Intergenic
988597503 5:32608300-32608322 CAGGGCCCCTAGACAGCTTCAGG - Intergenic
988645418 5:33090140-33090162 CAGGGCCACCAGACAGCTCCTGG + Intergenic
991358119 5:65791138-65791160 CACTGCACCCAGACAGTACCTGG - Intronic
991411220 5:66347444-66347466 CAGGGCACCCTACCAGATGCTGG - Intergenic
995298035 5:110542449-110542471 CAGGGCTTCCAGCCAGTTTCAGG + Intronic
995978995 5:118078739-118078761 AAGGGCACACAGACAGATGCTGG + Intergenic
997638884 5:135435567-135435589 CAGGGCACTCACACCGTTGCAGG + Intergenic
998390129 5:141781995-141782017 AGGGGCTCTCAGACAGTTGCTGG - Intergenic
998494040 5:142571482-142571504 CAGGGCACGCAAACAGAGGCTGG - Intergenic
999456681 5:151722513-151722535 CAGGGCACACAGAGAGCTTCTGG - Intergenic
1001851485 5:174970744-174970766 AAGGTCTCCCATACAGTTGCAGG - Intergenic
1003289198 6:4764574-4764596 CACTGCACCCAGTCAGTTGTAGG + Intronic
1005026440 6:21466996-21467018 GAGGTCACACAGACAGTTGAAGG - Intergenic
1005887814 6:30110450-30110472 CATGCCACCCAGGCAGCTGCTGG - Exonic
1006175003 6:32116376-32116398 CAGGGCATCCAGAGAGCTGCTGG - Intronic
1007094950 6:39207464-39207486 CAGGGAGCCCAGACAGGTGCAGG + Intronic
1009191179 6:60631781-60631803 CAGGGCAACCAGGCAGGAGCAGG - Intergenic
1012711890 6:102617388-102617410 CAAGGCTTCCAGACAGTTTCAGG + Intergenic
1013348149 6:109282160-109282182 CAGGGCACCTAGGCAGATGGAGG - Intergenic
1013403370 6:109820084-109820106 CAGGGCTCCCAGGCAGGTACTGG + Intronic
1014137466 6:117906902-117906924 CAGGACGCCGAGACAGGTGCCGG - Intergenic
1014648314 6:124003773-124003795 CAGGGCAGCAAAACAGCTGCAGG + Intronic
1018246849 6:161831984-161832006 CAAGACAGCCAGACAGTTGCTGG - Intronic
1019560455 7:1653533-1653555 CAGGGCACACAGACAGGGGCAGG - Intergenic
1019561032 7:1657477-1657499 CAGGGCACTTAGACAGTGCCTGG + Intergenic
1019867163 7:3722676-3722698 CATGGTGCCCAGACAGCTGCAGG + Intronic
1019892847 7:3960444-3960466 AATGGCATCCACACAGTTGCAGG - Intronic
1023089358 7:36603284-36603306 CAGGGGACCCAGATTGTTGACGG - Intronic
1024292581 7:47815430-47815452 CAGGCCACCCAAGCAGTTTCTGG + Exonic
1026150036 7:67780166-67780188 CAGGGAAGCCAGACAGGTACAGG - Intergenic
1027532802 7:79355595-79355617 AAGGCAACCCAGATAGTTGCAGG + Intronic
1030563170 7:111116797-111116819 CAGTGCACCTATACAGTTGGAGG + Intronic
1031495918 7:122447839-122447861 CACTGCACCCAGCCAGTTTCAGG + Intronic
1031965409 7:128024619-128024641 CACGGCACTCAGCAAGTTGCTGG + Intronic
1032089742 7:128905482-128905504 CAGGGGACCCAGCCAGTCACCGG + Intronic
1032742188 7:134749977-134749999 GAGGGCTCCCAGAAAGCTGCTGG + Intronic
1033598231 7:142871324-142871346 CAGGGCACCCAGGCAGGTGCAGG - Exonic
1035017976 7:155782783-155782805 CAGGCCATCCAGGCAGGTGCGGG + Intergenic
1037737760 8:21581014-21581036 CCCGGCACCCAGAGAGTTCCTGG + Intergenic
1037927449 8:22855203-22855225 CAGGTCACCCAGGCAATTACAGG - Intronic
1038581921 8:28755221-28755243 CAGGGCACTCAGCCAGGCGCTGG - Intronic
1040523684 8:48199451-48199473 CCGGGCCCCCAGACATTCGCTGG - Intergenic
1041329966 8:56714023-56714045 CAGGGCACCCAGTGACCTGCAGG - Intergenic
1042187718 8:66153832-66153854 GAGGGCACCCATCCAGATGCTGG + Intronic
1042302419 8:67299231-67299253 CAGGGCCCTCAGACAGATGAAGG - Exonic
1042959606 8:74289516-74289538 AAGGGCACCAATACAGGTGCTGG - Intronic
1043112213 8:76200338-76200360 CACTGCACCCAGTCAGATGCAGG + Intergenic
1043442306 8:80287056-80287078 CATGGCACCCAGGCAGGTGCAGG - Intergenic
1043443663 8:80299053-80299075 CATGGCACCCAGGCAGGTGCAGG - Intergenic
1043481480 8:80657095-80657117 CAGCCCACCCACACAGATGCAGG - Intronic
1049059292 8:140263712-140263734 CAGGTCACCCAGCCAGTAGGTGG + Intronic
1049444670 8:142624487-142624509 CAGGGCATCCAGACGGAGGCTGG + Intergenic
1050764211 9:9112217-9112239 GAGGGCACCCAGTGAGATGCTGG - Intronic
1055396283 9:75878240-75878262 CAATGCACCCAGACATTTGTAGG - Intergenic
1056936712 9:90920111-90920133 CAGGGCACCCAGACTGTTCCAGG - Intergenic
1061679523 9:132236094-132236116 CAGGACACCTGGGCAGTTGCTGG + Intronic
1062076924 9:134594643-134594665 CAGGGCACCTAGAGGGTTCCAGG - Intergenic
1062276622 9:135734326-135734348 CAGGGCACCAGGACGGGTGCAGG - Intronic
1188828011 X:34860659-34860681 CACAGCACCCGGCCAGTTGCGGG - Intergenic
1188984564 X:36757669-36757691 CAGGTCATCCAGTCAGTGGCTGG - Intergenic
1189098376 X:38163518-38163540 AAGGCCAACCAAACAGTTGCAGG + Intronic
1190247871 X:48702426-48702448 AAGGGCACCCTGACAGTATCGGG + Intronic
1190743492 X:53306305-53306327 GAGGGCACCCAGAGAGGTGGAGG + Intronic
1191677715 X:63809253-63809275 CAGGGTAGCCAGGCAGTTGCTGG - Intergenic
1197271254 X:124427002-124427024 CAGTGCACACAGACAGCTTCTGG - Intronic
1200092135 X:153640993-153641015 CAGAGCAGGAAGACAGTTGCAGG + Intergenic
1200124571 X:153807237-153807259 CAGGGCCCGCAGCCAGCTGCGGG - Intronic