ID: 923286080

View in Genome Browser
Species Human (GRCh38)
Location 1:232497177-232497199
Sequence TCCCATGCCTCCTCTGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923286080_923286083 24 Left 923286080 1:232497177-232497199 CCAACTACAGAGGAGGCATGGGA 0: 1
1: 0
2: 1
3: 18
4: 200
Right 923286083 1:232497224-232497246 TTCTACACTGATTGTGGCAATGG 0: 1
1: 0
2: 1
3: 26
4: 238
923286080_923286081 -10 Left 923286080 1:232497177-232497199 CCAACTACAGAGGAGGCATGGGA 0: 1
1: 0
2: 1
3: 18
4: 200
Right 923286081 1:232497190-232497212 AGGCATGGGAGAACGTTCTGAGG 0: 1
1: 1
2: 2
3: 25
4: 211
923286080_923286082 18 Left 923286080 1:232497177-232497199 CCAACTACAGAGGAGGCATGGGA 0: 1
1: 0
2: 1
3: 18
4: 200
Right 923286082 1:232497218-232497240 AAGCTATTCTACACTGATTGTGG 0: 1
1: 0
2: 0
3: 7
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923286080 Original CRISPR TCCCATGCCTCCTCTGTAGT TGG (reversed) Intronic
900471417 1:2856805-2856827 GCCCCTGCCTCCCCTGGAGTGGG - Intergenic
901408432 1:9066018-9066040 GACCATGCCTGGTCTGTAGTAGG + Intronic
903171034 1:21553848-21553870 CCCCATGCCTGGTCTGTAATAGG + Intronic
904396720 1:30227391-30227413 GCCCTTTCCTCATCTGTAGTTGG - Intergenic
906512183 1:46416370-46416392 TTCCAAGCCTCCTCAGTAGCTGG - Intergenic
907158510 1:52355251-52355273 TAACATGCTTCTTCTGTAGTTGG - Intronic
909687702 1:78369118-78369140 TCCCCAGCCTCCCCTGAAGTTGG - Intronic
913353734 1:117894240-117894262 TCCTCAGCCTCCTGTGTAGTTGG + Intronic
915171855 1:153983518-153983540 TACCATGGCTCCACGGTAGTAGG + Exonic
916569029 1:166008857-166008879 TCCCATTCCTCCTCAGCAGGTGG - Intergenic
917132214 1:171754852-171754874 TCTCCTGCCTTCTCTGTGGTTGG - Intergenic
920399200 1:205666680-205666702 TCTCATGCCACCTCCGTAGGAGG - Intronic
921408609 1:214810375-214810397 TCTCATGCCCCCTCTGTAAGAGG + Intergenic
923286080 1:232497177-232497199 TCCCATGCCTCCTCTGTAGTTGG - Intronic
1064298846 10:14103970-14103992 TACCATACCTTGTCTGTAGTTGG - Intronic
1065543474 10:26794303-26794325 TCTCCTGCCTCCTGTGTAGCTGG - Intronic
1069830274 10:71278721-71278743 TCCCCTCCCTCCGCTGTAGGTGG + Intronic
1073009565 10:100348687-100348709 TCCCATGCCTCCCAGGTAGAGGG - Intronic
1074644736 10:115435128-115435150 TCTCCTGCCTCCTGAGTAGTTGG + Intronic
1076242251 10:128917235-128917257 CCCCAGGACTCCTCTGGAGTCGG - Intergenic
1076701303 10:132274756-132274778 TCCAAAGCCTCCTCGGCAGTCGG + Intronic
1076767113 10:132642194-132642216 CCCCAGGCCTCCTCTGCAGATGG - Intronic
1077329916 11:1979702-1979724 TCCCATGACGCCCCTGTAATCGG + Intronic
1079628285 11:22642842-22642864 CCCATTGCCTGCTCTGTAGTTGG + Intronic
1083764714 11:64836290-64836312 TCCCCTGCCTCCTCAGGAGCTGG - Exonic
1083912675 11:65719392-65719414 GCCCAGGCCTCCTCTGAAGCAGG + Exonic
1085259867 11:75198342-75198364 GCACATTCCTGCTCTGTAGTAGG - Intronic
1085411254 11:76292029-76292051 TCCCATGCCTCTCCTGTAGATGG - Intergenic
1086427350 11:86698835-86698857 TCCCAGGCCTACTGTGTATTGGG - Intergenic
1088027902 11:105208704-105208726 TTCAATGCCTTCTCTGTACTGGG + Intergenic
1088294889 11:108282074-108282096 TCCCAAGCCTCCTGAGTAGCTGG + Intronic
1202812894 11_KI270721v1_random:34881-34903 TCCCATGACGCCCCTGTAATCGG + Intergenic
1095207613 12:39456684-39456706 TCCCCAACCTCCTATGTAGTTGG + Intergenic
1095400907 12:41813982-41814004 GCCCATGCCTCCTGTGCAGAGGG - Intergenic
1095574673 12:43722727-43722749 TCCAATGCCTCCCCTGTGGCAGG - Intergenic
1095775921 12:46009957-46009979 TCCTCAGCCTCCTCTGTAGCTGG - Intergenic
1096058992 12:48680861-48680883 TCTCCTGCCTCCTAAGTAGTTGG - Intronic
1097015151 12:55980785-55980807 GCCCATGGCTCCACGGTAGTAGG + Intronic
1097091960 12:56513233-56513255 ACCCATGCCTCCTGAGTAGCTGG - Intergenic
1097160657 12:57044342-57044364 TCCCCTGCCTCCTTTGTTTTGGG + Intronic
1097364328 12:58694654-58694676 TCCCTTGCCTCCTTTTTAATAGG - Intronic
1098361286 12:69656796-69656818 TCCCTTGACCCCTGTGTAGTAGG - Intronic
1101233515 12:102765791-102765813 ACCAAAGCCTCCTCTGTAGGGGG + Intergenic
1102225458 12:111225151-111225173 TCCCATCACTCCTATGAAGTGGG - Intronic
1102739678 12:115196090-115196112 TCCCATGCCTCCCATGTGCTGGG + Intergenic
1103863752 12:124034882-124034904 TCCCATCTCTCCTCTCTAATCGG - Intronic
1104152821 12:126100764-126100786 TTCCAAGCCTGCTCTCTAGTTGG - Intergenic
1105995184 13:25664384-25664406 ACCCACGCCTCTTCTGGAGTGGG + Intronic
1106254365 13:28009409-28009431 TCCCAGGCATCCTCTGTGGTGGG + Intronic
1106568234 13:30905555-30905577 TCCCCTGCCTCCCCAGTAGGTGG - Intergenic
1109058449 13:57582197-57582219 TCACAGGCATCCTCTGTGGTAGG + Intergenic
1112948971 13:104966908-104966930 TCACATGCCTCCTCAACAGTAGG - Intergenic
1114538829 14:23439874-23439896 TCTCATGCCTCCTGAGTAGCTGG - Intergenic
1117217899 14:53570624-53570646 TCCCCTGAGTCCTCTGTGGTGGG - Intergenic
1117670490 14:58101028-58101050 TCACCTGCCGCCTGTGTAGTGGG + Intronic
1119183833 14:72622522-72622544 TCCCATGTCACTGCTGTAGTAGG - Intronic
1119797234 14:77409914-77409936 TCTCATTCCTCCCCTGTAGCTGG + Intronic
1120296330 14:82646641-82646663 TCCCCTGTCTCCCCTGAAGTAGG + Intergenic
1120584420 14:86294144-86294166 TACCATGCCTTCTCTATTGTAGG + Intergenic
1121351861 14:93179838-93179860 TCACTTGCCCCCTCAGTAGTGGG - Intergenic
1125794629 15:42395158-42395180 ACCTGTGCCTCCTATGTAGTAGG - Intronic
1126854166 15:52821736-52821758 TCTCCTGCCTCCTGAGTAGTGGG - Intergenic
1127265285 15:57355975-57355997 CTCCATGCCTTCTCTGGAGTGGG + Intergenic
1128944388 15:71811194-71811216 TCCCATCCCTTCTCTGTGGGTGG - Intronic
1131424786 15:92336807-92336829 TCCCTTGACTCTTCAGTAGTAGG - Intergenic
1132121110 15:99176180-99176202 GCCCATGCCTCTCCTATAGTAGG - Intronic
1133730369 16:8573326-8573348 TCTCTTGCCTCCTCTCTAGTAGG + Intronic
1133887344 16:9842820-9842842 TCTTATGCCTCCTGTGTAGCTGG - Intronic
1134475101 16:14566629-14566651 CAACTTGCCTCCTCTGTAGTAGG - Intronic
1136370685 16:29834112-29834134 TCCCCTGCTTCCCCTGCAGTGGG - Intronic
1139011221 16:62636819-62636841 TCTCCTGCCTCCCCAGTAGTTGG + Intergenic
1141864674 16:86741849-86741871 TCCATTTCCTCCTCTGTAGGTGG + Intergenic
1142392001 16:89807340-89807362 GCCCCTGCCTCCTCAGTAGCTGG - Intronic
1143200987 17:5112848-5112870 TCTCCTGCCTCCTGAGTAGTGGG - Intronic
1144631979 17:16878450-16878472 TCCCATGACTGTGCTGTAGTTGG + Intergenic
1145032730 17:19517314-19517336 TCCCAGGCCTCCTCTGCTGCGGG - Intronic
1147145928 17:38484455-38484477 TCCCATGCCTCAGCTGCAGCAGG - Intronic
1147245451 17:39117272-39117294 TCCCCTGCCACCTCTGGACTAGG + Intronic
1148050807 17:44769227-44769249 TCCGAGGCCTCCTATGTAGATGG + Intronic
1148762012 17:50009539-50009561 TCCCATGCCTCTTCTCTATCTGG + Intergenic
1148816860 17:50334411-50334433 TCTCATGCCTCCCCAGTAGCTGG + Intergenic
1149679442 17:58495114-58495136 TCCAGTGCCTCCTCTGTATTTGG - Exonic
1151221570 17:72616632-72616654 TCCCCTGCCTTCTCTGTTGGGGG - Intergenic
1152553053 17:81039398-81039420 TCCCATGCCTGCTGTGCCGTTGG + Intronic
1153323713 18:3797215-3797237 TCCCCTGCCTCCTGAGTAGCTGG - Intronic
1153353443 18:4108084-4108106 TCCCCTGACTCCCCTGAAGTGGG + Intronic
1153937019 18:9936630-9936652 TCCCATGCCTCCTGGGTAGCTGG - Intronic
1155559955 18:27064904-27064926 TCACATGCCACCTCTTTAGCAGG + Intronic
1157109718 18:44809279-44809301 CCCCAAGCATTCTCTGTAGTAGG + Intronic
1157232067 18:45926702-45926724 TCTCCTGCCTCCTGAGTAGTTGG - Intronic
1157535163 18:48452503-48452525 TCCCATGCCTCGTACGTAATAGG + Intergenic
1160532395 18:79573107-79573129 GCGCAAGCCTCCTCTGCAGTGGG - Intergenic
1161516577 19:4699893-4699915 TCCCAGGCCACCTCGGGAGTGGG - Intronic
1162546799 19:11335721-11335743 GCCCATGGCTCCCCGGTAGTAGG + Exonic
1165144689 19:33723885-33723907 TCCCATGCCCCTTCTGGTGTGGG + Intronic
1165441654 19:35831681-35831703 TCCAATGCCTCCTGTGTCGGGGG - Exonic
1167571238 19:50290372-50290394 TCCCATGTCTCCCCTCTACTAGG + Intronic
1168445310 19:56406639-56406661 TCTCCTGCCTCCTCAGTAGCTGG + Intronic
925838029 2:7964798-7964820 TCCCATTCATCCTCAGTAGATGG - Intergenic
926297745 2:11580881-11580903 TCCCATGCCCCCTCTGGCCTTGG - Intronic
927802033 2:26109809-26109831 ACCCATTGCGCCTCTGTAGTAGG - Exonic
928403166 2:30993843-30993865 TCCCTTGCCTCCTCTGCTGGAGG - Intronic
931377242 2:61718481-61718503 TGCAATGCTTCCTCTGTAGCAGG + Intergenic
932434916 2:71697515-71697537 TCACCTGCCTCCTCTGCAGAAGG + Intergenic
933728843 2:85442043-85442065 TCACATGCCTGATCTATAGTGGG - Intergenic
935640261 2:105283397-105283419 TCCCTTGCCTGTTCTGTAGGAGG - Intronic
936477791 2:112855085-112855107 TCCCATGCCTCCTGTGTAGCTGG + Intergenic
942217450 2:173735997-173736019 TCCCACACCTCTTCTGTAATGGG + Intergenic
942523391 2:176828422-176828444 TCTCATGCCTGTTCTATAGTAGG - Intergenic
946127470 2:217576287-217576309 TCCCATTCCTTATCTGTAATGGG - Intronic
948740536 2:240043155-240043177 TCCCATGTCTCCTCTGGCCTTGG + Intergenic
948783458 2:240339038-240339060 TCCTATGTCTCCTCTGTATTAGG - Intergenic
1168950279 20:1794106-1794128 GCCCCAGCCTCCTCTGTAGCTGG - Intergenic
1169908790 20:10630269-10630291 TCACCTGCCTCCTCTGGAGCAGG - Intronic
1171304622 20:24094611-24094633 TTCCCTGCCTCCTCTGTCCTTGG + Intergenic
1171954676 20:31451849-31451871 TCCTCAGCCTCCTGTGTAGTTGG + Intergenic
1172010104 20:31841691-31841713 CCCCATTCCTCCTCTTTAGCAGG - Intergenic
1172350494 20:34235667-34235689 ACCCCTGCCTCCTGAGTAGTAGG - Intronic
1172758730 20:37307074-37307096 TCCTCTGCCTCCTCAGTAGCTGG + Intronic
1172902873 20:38347618-38347640 TCCCATGCCACCTGGATAGTCGG - Intronic
1172987153 20:39000847-39000869 ATCCATGCCCCCTCTGCAGTGGG + Intronic
1175128291 20:56768888-56768910 GCTCATGCCTCATCTGTAGGTGG + Intergenic
1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG + Intronic
1175363279 20:58431957-58431979 ACTCATGCCTCCTGTGTAATAGG - Intronic
1178536704 21:33415968-33415990 TCTCATGCCTCCTGAGTAGCTGG + Intronic
1179588996 21:42392922-42392944 CCCCACGCCTCCTCTGTGCTTGG + Intronic
1183420721 22:37709840-37709862 TCCCCTGCCTCTCCTTTAGTGGG + Intronic
1183546817 22:38458709-38458731 TCAGAGGCCTCGTCTGTAGTGGG + Intergenic
950554334 3:13686108-13686130 TCCCATCCCCACTCTGTGGTCGG - Intergenic
952644155 3:35636078-35636100 AGCCATGTCTCTTCTGTAGTAGG - Intergenic
953003750 3:38958364-38958386 TCCCTTGCCTCTTCTGATGTGGG + Intergenic
953029584 3:39170003-39170025 TCCAAAGCTTCCTCTGAAGTTGG - Intergenic
954391373 3:50269669-50269691 TCTCATGCCTCCTGTATAGGAGG + Intronic
955052716 3:55428367-55428389 ACTCATGCCTCCTCTGAAGAAGG + Intergenic
956653748 3:71529740-71529762 TGCCATGCCTTCTCTGGAGGTGG - Intronic
957760334 3:84548129-84548151 TCCCAGGCCTGCTCTGCAGTGGG + Intergenic
958195342 3:90235901-90235923 TCCAGGGCCTCCTCTGTACTGGG + Intergenic
959095916 3:101955575-101955597 TCCCAGAACTCCTCTTTAGTTGG - Intergenic
961314155 3:126023122-126023144 TCTCAGGCCTCCAGTGTAGTGGG - Intronic
961449353 3:126995445-126995467 TCCCCAGCTTCCTCTGTAGGGGG - Intronic
966031606 3:175355693-175355715 TCCCAGGCATCTTCTGAAGTAGG - Intronic
966217351 3:177517534-177517556 TCCCCTGCCTCCTGAGTAGCTGG + Intergenic
971605475 4:28652146-28652168 TCCCATACCTCCTCACTGGTTGG - Intergenic
971969791 4:33606236-33606258 TCCCATCCCTCCTCACTAGTTGG + Intergenic
975106247 4:70571912-70571934 TCCCATTCCTACTCTGTGGGTGG - Intergenic
975514454 4:75230792-75230814 TGCCATGCCTACTCTGTATCAGG - Intergenic
982010924 4:151105649-151105671 TCTCAGGCCTCCTGAGTAGTTGG + Intronic
982550984 4:156798924-156798946 TCCAATACCTCCTCTGAAATTGG - Intronic
982561465 4:156933063-156933085 TCCCATGCCTTCTCTGAATCGGG + Intronic
985027711 4:185754915-185754937 TCCCCAGCCTCCTCTGCAGTTGG - Intronic
985644954 5:1080430-1080452 TCCCTTGCCTCCACTGAAGGTGG - Intronic
985933322 5:3076490-3076512 TCCAATGCCTCCTCTGTGGCGGG + Intergenic
986442879 5:7797113-7797135 GCCCATGCGTCCTCTGCAGGAGG + Intronic
986977585 5:13410906-13410928 TCCCATGGCACCTGTGTTGTGGG - Intergenic
988525907 5:31987343-31987365 TCCTATGCCTCCTCTGTAAGTGG + Intronic
990729011 5:58787886-58787908 TCCCCTCCCTCCACTGTTGTTGG + Intronic
991135377 5:63176319-63176341 TCCCATTCCTCCTCACTAGTTGG - Intergenic
993243105 5:85415690-85415712 TCCTATTCCTCCTCTCTAGGTGG - Intergenic
993792293 5:92222911-92222933 TCCCATTCCTCCTCCCTAGGAGG - Intergenic
994439483 5:99784304-99784326 TCCCATGACTTTTCTGTAGAAGG + Intergenic
997648305 5:135496147-135496169 TTTCATGCCTTCTATGTAGTAGG - Intergenic
999210316 5:149882450-149882472 TCCCCTGGCTCCTCTGTGATGGG - Intronic
999317978 5:150596452-150596474 TCCCAGGCCTCCTAGGTACTTGG + Intergenic
999341618 5:150778467-150778489 TCCCATGTCTACTCTATAGCTGG + Exonic
999744249 5:154579579-154579601 TCCCTTTCTTCCTCTGCAGTTGG - Intergenic
1000788398 5:165574360-165574382 TTCCAAGCCTCCTCAGAAGTTGG + Intergenic
1001733924 5:173982798-173982820 ACCCCTGCCTCCTGTGTAGTGGG - Intronic
1002045859 5:176541588-176541610 CCCCAGGCCTCCTCTGCAGTGGG + Intergenic
1003371973 6:5537419-5537441 TCCCAGGCCTCCTCTCGAGTTGG + Intronic
1003371987 6:5537475-5537497 TCCCGGGCCTCCTCTCGAGTTGG + Intronic
1003371994 6:5537503-5537525 TCCCGGGCCTCCTCTCGAGTTGG + Intronic
1003372001 6:5537531-5537553 TCCCGGGCCTCCTCTCGAGTTGG + Intronic
1004358127 6:14947855-14947877 TCTCATGCCTCCTGAGTAGCTGG + Intergenic
1007204284 6:40135922-40135944 TCCCATGATTCCCCTGTTGTGGG + Intergenic
1011564818 6:88663574-88663596 TGCCATGCATCCTCTGATGTGGG - Intronic
1013738743 6:113258966-113258988 TCCCCTGCCTCCTAGGCAGTGGG - Intergenic
1014900634 6:126959723-126959745 TCTCATGCCTCCTCAGTCATAGG + Intergenic
1015881492 6:137874604-137874626 TCCCCTGGCTCCTTTGCAGTTGG + Intronic
1018286709 6:162248116-162248138 TTCCATAGCTCTTCTGTAGTGGG - Intronic
1018379637 6:163246562-163246584 TCACATGCTGCCTCTCTAGTTGG - Intronic
1020528728 7:9300369-9300391 TCTCAAGTCTCATCTGTAGTTGG + Intergenic
1022519562 7:30997301-30997323 TCTCATGCCTGCTCTGTGCTAGG - Intergenic
1022561043 7:31349812-31349834 TACGATGCTTCCTATGTAGTAGG - Intergenic
1023920463 7:44625591-44625613 TCCTGTGCCTCATCTGTAGGTGG + Intronic
1026203421 7:68234757-68234779 TCACTTGCCTCCTCTGTAAAAGG - Intergenic
1026854249 7:73742749-73742771 TCCCAGGCTTCCTGTGAAGTGGG + Intergenic
1032896496 7:136256858-136256880 TCCCCTGGTTCCTCTGTAGATGG + Intergenic
1035067061 7:156113886-156113908 TCCCATGCTTCCCCTGAAGGCGG + Intergenic
1038072352 8:24031061-24031083 TACCAGGACTCCACTGTAGTGGG - Intergenic
1039723832 8:40193723-40193745 TCCTCAGCCTCCTCAGTAGTTGG - Intergenic
1044931070 8:97252066-97252088 TGCCATGCCTCCTCTGCACTAGG - Intergenic
1047007010 8:120630910-120630932 TACCAGGCTTCCTCTCTAGTTGG - Intronic
1048448341 8:134509843-134509865 GCCCATGCATCCTCTGGAGAAGG - Intronic
1049080395 8:140438528-140438550 TGCCATGCGTCCTCTGAAGGAGG - Intronic
1049257359 8:141621067-141621089 CCCCATGCCTCCTCTGTGATTGG - Intergenic
1049308887 8:141922924-141922946 TCCCATGGCTTCTCTATACTGGG + Intergenic
1049517133 8:143066275-143066297 TCTCATGCCTCCTGAGTAGCTGG + Intergenic
1049704402 8:144034076-144034098 TCCCCTCCCTCTTCTGCAGTTGG + Intronic
1053244666 9:36525037-36525059 TCCCCTGCCTCCCATGTAGCTGG + Intergenic
1053260317 9:36657697-36657719 TCTCATGCCTCCTGAGTAGCTGG + Intronic
1056491568 9:87112920-87112942 TCCCATGACTGCTCTGTGGTGGG - Intergenic
1056621918 9:88221724-88221746 CCCCAAGTGTCCTCTGTAGTGGG + Intergenic
1057919110 9:99082109-99082131 TCCCACGCCTGCTATGTACTGGG - Intergenic
1059768000 9:117402179-117402201 GCCCCGGCCTCCTCTGTAGCTGG + Intronic
1060861243 9:126956559-126956581 TGCCATGCTTCATCTGTAGGTGG + Intronic
1061074260 9:128331657-128331679 TCCCAAGCCTCCTGAGTAGCTGG + Intronic
1061707760 9:132466188-132466210 TCCTAAGCCTCCTGAGTAGTTGG + Intronic
1186225599 X:7395932-7395954 TCCCATGTCTCCTGTGGTGTGGG + Intergenic
1187064123 X:15816255-15816277 TCCCTTCCTTCCTCTGTAGGTGG + Intronic
1190688537 X:52894974-52894996 TACCGTGCCTCATCTGTAATAGG + Intronic
1190697446 X:52960818-52960840 TACCGTGCCTCATCTGTAATAGG - Intronic
1193171192 X:78337931-78337953 TTCAATGCCTCCTTTGTAGAGGG + Intergenic
1193678419 X:84485510-84485532 TCTCATGCCTCCTGAGTAGCTGG + Intronic
1196710536 X:118757413-118757435 TCTCATGCCTCCTGAGTAGCTGG - Intronic
1196782477 X:119395876-119395898 TCTCATGCCTCCCCAGTAGCTGG - Intergenic
1196887598 X:120262777-120262799 TCTCATGTCATCTCTGTAGTGGG - Intronic
1196931637 X:120687412-120687434 TCCTAAGCCTCCTAAGTAGTTGG + Intergenic
1197173344 X:123458476-123458498 TCCTATGCCTCCTCTGAGCTAGG + Intronic
1198106222 X:133463971-133463993 TCCCATGCCTCCCGAGTAGCTGG + Intergenic
1199619424 X:149686138-149686160 TTCCATACATCCTCTGAAGTAGG - Intergenic