ID: 923288024

View in Genome Browser
Species Human (GRCh38)
Location 1:232515694-232515716
Sequence CTTTGTGGGCAGAAGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 6, 3: 37, 4: 348}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923288024_923288030 17 Left 923288024 1:232515694-232515716 CCCCTCTGCTTCTGCCCACAAAG 0: 1
1: 0
2: 6
3: 37
4: 348
Right 923288030 1:232515734-232515756 CTGTTCGTAACACTCCTCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923288024 Original CRISPR CTTTGTGGGCAGAAGCAGAG GGG (reversed) Intronic
900768685 1:4523116-4523138 CTTTGAGGTCAGAACCAGACAGG - Intergenic
901632416 1:10654373-10654395 CTTCGTGGGCAGAAGCGGGGAGG - Intronic
903060151 1:20663657-20663679 CTATGTGGGCACAAACAGGGTGG + Intergenic
903117841 1:21192714-21192736 CTTGGTGGGCAGTGCCAGAGTGG - Intergenic
903226552 1:21897048-21897070 CTATGTGGGCCGGAGCAGAAGGG + Intronic
903622000 1:24704679-24704701 CTGTGGGGGCAGACTCAGAGAGG + Intergenic
903692877 1:25186624-25186646 CTGTGTGGGCGGAAGGAGAAGGG - Intergenic
905214742 1:36398860-36398882 CTTTGAAGGCTAAAGCAGAGGGG - Intergenic
907826470 1:58021890-58021912 CATTGTGTTCAGAAGCAGAAGGG + Intronic
907932262 1:59011526-59011548 ATGTGTGGAAAGAAGCAGAGAGG + Intergenic
910939215 1:92515067-92515089 CTTAGTGGGGAGGAGGAGAGAGG + Intronic
912777141 1:112512974-112512996 CTATGTGGGCTGCAGCAGAATGG + Intronic
912956620 1:114158202-114158224 CTTTGTGGACAAAAGCAGGCTGG + Intergenic
913216870 1:116628096-116628118 GTGTGTGGGCAGAAGTGGAGAGG + Intronic
913592339 1:120341475-120341497 CTTTGAGGGCAGAACCCGCGTGG - Intergenic
913651020 1:120913670-120913692 CTTTGAGGGCAGAACCCGCGTGG + Intergenic
914170094 1:145215397-145215419 CTTTGAGGGCAGAACCCGCGTGG - Intergenic
914525213 1:148459360-148459382 CTTTGAAGGCAGAACCCGAGTGG - Intergenic
914598465 1:149176470-149176492 CTTTGAGGGCAGAACCCGCGTGG + Intergenic
914641191 1:149607774-149607796 CTTTGAGGGCAGAACCCGCGTGG + Intergenic
915741252 1:158120097-158120119 CCGTGTGGGCAGAGGAAGAGGGG - Intergenic
916606895 1:166351884-166351906 CTTTCTTGGCAGAGACAGAGGGG - Intergenic
917796677 1:178537923-178537945 CTCTGGGGCCAGAGGCAGAGAGG - Intronic
919134272 1:193488835-193488857 CTTTGGGGGTAGAAGCTGGGAGG - Intergenic
919556764 1:199065205-199065227 GGTTGTGGGTAGAAGAAGAGAGG + Intergenic
919932379 1:202229694-202229716 GGTTGTGGGCAGAAGTTGAGTGG + Intronic
920872195 1:209804365-209804387 CTTGGTGCGCAGAAGATGAGAGG - Intronic
923288024 1:232515694-232515716 CTTTGTGGGCAGAAGCAGAGGGG - Intronic
923665083 1:235992382-235992404 CTGTGGGGGTAGAAGCTGAGAGG - Intronic
924122004 1:240810171-240810193 TTTAGTTGGGAGAAGCAGAGAGG - Intronic
924428312 1:243974077-243974099 TTTTGTGTGCAGAAGCCCAGTGG + Intergenic
924497696 1:244606290-244606312 CTTTGTAGGCCGCAGCAGAGTGG + Intronic
1063310969 10:4951337-4951359 CTTTGTGGACAGAAGCAGCCTGG + Intronic
1063883177 10:10551646-10551668 CTTAGTGGGCATGCGCAGAGTGG - Intergenic
1064230011 10:13521578-13521600 TTTTGTGGGGAGGAACAGAGGGG + Intronic
1065171443 10:23034546-23034568 CTATATGGGTAGAAGCAGTGTGG - Intronic
1065821768 10:29532351-29532373 ATTAGTAGGCAGAAGCAGAGTGG + Intronic
1068556605 10:58465480-58465502 CATTGTGGGCAGAAAGGGAGGGG - Intergenic
1068956364 10:62821465-62821487 ATTTGTCTGCAGAAGCTGAGTGG - Intronic
1069949465 10:72009177-72009199 CCCTGTGGGCATAAGCAGCGAGG - Exonic
1071648544 10:87374902-87374924 CTGTGTGGGCAGAGGAGGAGAGG - Intergenic
1072024073 10:91436433-91436455 GTTTGTGGGGAGAAGGAGATTGG + Intronic
1072520849 10:96228663-96228685 CTCTGCGGTGAGAAGCAGAGAGG - Intronic
1073138986 10:101235598-101235620 CGTTGGGCCCAGAAGCAGAGAGG + Intergenic
1073320986 10:102616168-102616190 CACTGTGGACAGAAGCAGAAGGG - Intronic
1073498769 10:103917855-103917877 CTTTGTGGGAAGGAGAACAGCGG - Intronic
1074284289 10:112083422-112083444 ATTTGGGGGCAGGAGGAGAGAGG - Intergenic
1074683334 10:115933478-115933500 GCTTGTGGGCGGCAGCAGAGTGG - Intronic
1074769775 10:116725633-116725655 CTTTGCTGGCAGAAGGAGTGGGG + Intronic
1074854713 10:117465024-117465046 CCATGTGGGCAGAGGCAGTGAGG + Intergenic
1075545964 10:123354909-123354931 CTTGGTAGGGAGAAGCGGAGAGG - Intergenic
1075995993 10:126876644-126876666 CTTTGAGGGCAGGGGCAGGGTGG + Intergenic
1076389313 10:130086243-130086265 GTTTGTGTGGAGAAGCTGAGGGG - Intergenic
1076468579 10:130702857-130702879 CTTAGTGGCCAGAGGGAGAGGGG + Intergenic
1076540433 10:131211102-131211124 CTTTGGGGACAGCAGCAAAGGGG + Intronic
1076807614 10:132866833-132866855 CTTTATGGGCAAATGCAGAGGGG + Intronic
1077347672 11:2071534-2071556 CCATGTGGTCATAAGCAGAGAGG - Intergenic
1077478504 11:2802266-2802288 CTTTGAGGGCAGCAGGACAGGGG + Intronic
1078267552 11:9766311-9766333 CTTTGTGGGCAGAATGAGCTTGG - Intergenic
1078929699 11:15903660-15903682 TTCTGTGAGCAGAGGCAGAGGGG - Intergenic
1080393655 11:31871010-31871032 CTGTGTGGCCAGGAGGAGAGAGG + Intronic
1080689091 11:34540943-34540965 CTTCAGGGGCAGAAGCAGAGAGG - Intergenic
1080905655 11:36542394-36542416 CTTTGTGTGTAGAAGGAAAGAGG - Intronic
1080916173 11:36662538-36662560 GTTTGGGAGCAGAAGCAGCGAGG + Intergenic
1080994255 11:37580802-37580824 CTGTGTGGGCAAAAGGAAAGAGG + Intergenic
1081015378 11:37871491-37871513 CATTTTGGCAAGAAGCAGAGAGG + Intergenic
1083300001 11:61735273-61735295 AATTGAGGGCAGAAGCAGGGAGG + Intronic
1083753604 11:64777749-64777771 CTCTGTGCGCAGACGCAGTGAGG - Intronic
1084162770 11:67359090-67359112 CATGGTGGGCAGAAGTAGAAGGG - Intronic
1084319428 11:68365251-68365273 CTTGGTGGGAGGAAGCAGATGGG + Intronic
1084455526 11:69266059-69266081 CTGTGTGGGCAGGACCTGAGGGG - Intergenic
1084613689 11:70220423-70220445 CTTGGAGGCCAGAAGCAGGGCGG - Intergenic
1085985266 11:81779433-81779455 CTGTGCAGGCAGAGGCAGAGTGG - Intergenic
1086097365 11:83064036-83064058 CTTTGTGGGTAGAATTAAAGAGG + Intronic
1087124338 11:94608162-94608184 CTTTGTGGGGAGTGGGAGAGAGG - Intronic
1087640977 11:100753423-100753445 CTTTGTGGGCAGATGAGGAGTGG - Intronic
1088628896 11:111754986-111755008 CTTTGTGGGCAGCAGCTGCCCGG + Exonic
1089047278 11:115513167-115513189 CTTTCCGTGCAGAAGCAGAGGGG + Intergenic
1089092519 11:115889817-115889839 CTTTGCTGGAAGATGCAGAGTGG + Intergenic
1089299163 11:117488118-117488140 GTTAGTTGGCAGAAGAAGAGGGG - Intronic
1089622645 11:119730271-119730293 CTAGGCGGGCAGGAGCAGAGGGG + Intergenic
1091352465 11:134908029-134908051 CTTGGTGGGATGCAGCAGAGGGG - Intergenic
1093847746 12:23994671-23994693 GTGTGTGGGCAGGAGGAGAGAGG + Intergenic
1094631015 12:32173949-32173971 CTCTGTGGGAAGAAGCAGAGTGG - Intronic
1100501980 12:95183166-95183188 CTTTATCAGCAGAAGCATAGTGG - Intronic
1101825942 12:108219997-108220019 ATTTGTGGTGAAAAGCAGAGTGG + Intronic
1102499499 12:113341705-113341727 CATTGTGAGCAGAAGTAGTGTGG + Intronic
1102713944 12:114953331-114953353 CTTAGTGTGCAGAGGCAGGGAGG + Intergenic
1102727969 12:115082184-115082206 CAATGAGGGCAGCAGCAGAGTGG + Intergenic
1102825105 12:115942507-115942529 CTGTGAGGTCAGAGGCAGAGGGG - Intergenic
1103557092 12:121773307-121773329 TTTACTGGGCAGAAGCAGAAAGG - Intronic
1104167099 12:126242736-126242758 CCTTGGGGGCAGAAGAAGAGTGG - Intergenic
1105894226 13:24704803-24704825 TTTTGTGGCCATGAGCAGAGTGG - Intronic
1105928107 13:25026251-25026273 GTTTGTGGGGTGGAGCAGAGGGG + Intergenic
1105942786 13:25164829-25164851 GTTTGTGGGGTGAAGCAAAGTGG - Intronic
1106239540 13:27899798-27899820 CTTAGAGGGGAGGAGCAGAGAGG + Intergenic
1106280458 13:28263616-28263638 TTTTGTGGCCTGAAGCACAGTGG - Intronic
1106487699 13:30187094-30187116 GTTTGTGTGCAGTAGCAGGGAGG + Intergenic
1106550091 13:30763555-30763577 CGTTATGGGCAGCTGCAGAGAGG + Intronic
1107285137 13:38781972-38781994 CTTGGAGGGCAAAAGCAGAGTGG - Intronic
1110575205 13:77047763-77047785 TTTTGTGGGCATAGGCACAGTGG + Intronic
1112402651 13:99088937-99088959 CTTTATGGGTTAAAGCAGAGGGG + Intergenic
1113348087 13:109500247-109500269 GTTTGTGGACAGAAGCAGGATGG + Intergenic
1114174243 14:20305379-20305401 CTTTGGGGTCTGATGCAGAGGGG - Intronic
1114217435 14:20667375-20667397 TTTTGAGGGCAAAAGCAGAAGGG - Intergenic
1117049169 14:51843612-51843634 GGTTGAGGGCAGGAGCAGAGTGG - Intronic
1118046781 14:61978713-61978735 TTGTGTGGGCAGCAGCAAAGGGG - Intergenic
1118170889 14:63387420-63387442 CTGTGTGTGCAGAAGGACAGTGG - Intronic
1118320237 14:64748606-64748628 ATCTGGGGGGAGAAGCAGAGAGG + Exonic
1118387555 14:65268943-65268965 CGCTGTGATCAGAAGCAGAGTGG + Intergenic
1119124699 14:72114956-72114978 TTTTGTGGGAAGAATCACAGAGG + Intronic
1119477698 14:74940608-74940630 CTTGCAGGTCAGAAGCAGAGTGG + Intergenic
1120707195 14:87757114-87757136 CTTTGTGGGAGGCTGCAGAGAGG - Intergenic
1121363880 14:93289044-93289066 TTGTGGGGGCAGTAGCAGAGAGG + Intronic
1121579078 14:95013138-95013160 CTTTATGGGCATAAACAGGGGGG + Intergenic
1122847505 14:104507937-104507959 CTGCCTGGGCAGAAGCTGAGAGG + Intronic
1122871658 14:104641525-104641547 CTCTGTGAGCGTAAGCAGAGGGG - Intergenic
1124653537 15:31489541-31489563 GTCTGTGGGCAGAAGCAATGTGG + Intronic
1124715661 15:32058733-32058755 CTGTGGGGGCAGAACTAGAGTGG + Intronic
1125771694 15:42171902-42171924 CTTTGCCTTCAGAAGCAGAGGGG + Intronic
1125889281 15:43253635-43253657 CTTCGGGGGGAGAGGCAGAGAGG + Intronic
1126559693 15:50029695-50029717 TATTGTGTGGAGAAGCAGAGAGG + Intronic
1127360906 15:58244431-58244453 CTTGGTGGGAAGCTGCAGAGGGG - Intronic
1127631997 15:60836271-60836293 CTTTATGTGCAGATGGAGAGAGG + Intronic
1127905173 15:63371123-63371145 CTGTGTGGGAAGAGGCTGAGAGG + Intronic
1128682598 15:69662593-69662615 CCTTGGGGGCAGGAGCAGAGAGG + Intergenic
1129709104 15:77811179-77811201 CTCTGTTGGCAGAAGCAGCTGGG - Intronic
1130694611 15:86118364-86118386 TTTTGTGAGCATAAACAGAGGGG - Intergenic
1130936688 15:88476970-88476992 CTCTCTGGAGAGAAGCAGAGTGG - Exonic
1131383810 15:91986107-91986129 CCTGGTGGGCAGAGGCTGAGTGG + Intronic
1131868990 15:96742310-96742332 TATTGTGAGCAGAAGCATAGTGG + Intergenic
1131958506 15:97763689-97763711 CTTTGTGGGCTGAGGTGGAGTGG - Intergenic
1132405063 15:101536914-101536936 CCCTGTGGGCAGCAGCAGATGGG - Intergenic
1133434409 16:5766788-5766810 CCTTGAGGGCAGAAGCAGGGTGG - Intergenic
1133617457 16:7491411-7491433 CATTGTGAGCAGAAGCAGCCTGG + Intronic
1133867980 16:9661559-9661581 GTTTGTCTGCAGAAGCAAAGAGG + Intergenic
1133887418 16:9843648-9843670 CTGGGTTGACAGAAGCAGAGTGG - Intronic
1133905364 16:10017150-10017172 TTTTGTGGTCAGAAGATGAGGGG - Intronic
1134053696 16:11156002-11156024 CTTTTTGGCCAGAAGCAGGGAGG - Intronic
1135887879 16:26328885-26328907 CTTTGTGGGAAGGAGCACACAGG + Intergenic
1135985224 16:27179135-27179157 CTTTGTGCACAAAAGCAGATAGG + Intergenic
1135996830 16:27256402-27256424 GCTTGTGAGGAGAAGCAGAGTGG - Intronic
1137100818 16:36381080-36381102 CTTTGAGGCCAAAAGCAGAAAGG + Intergenic
1137125077 16:36782741-36782763 CTTTGAGGCCAAAAGCAGAAAGG + Intergenic
1137162192 16:37397519-37397541 CTTTGAGGCCAAAAGCAGAAAGG + Intergenic
1137168110 16:37495394-37495416 CTTTGAGGCCAAAAGCAGAAAGG + Intergenic
1137201994 16:38055829-38055851 CTTTGAGGCCAAAAGCAGAAAGG + Intergenic
1138115729 16:54359005-54359027 CTTTTTGGGCAGTGGCTGAGTGG + Intergenic
1139210091 16:65068297-65068319 CCTTGTGTGCTGAAGAAGAGAGG - Intronic
1139282820 16:65784804-65784826 CTGTAAAGGCAGAAGCAGAGTGG + Intergenic
1140572418 16:76123740-76123762 CTTTGAGGGCAGGAAAAGAGGGG + Intergenic
1140992794 16:80230664-80230686 CCTGGTGAGCAGAGGCAGAGTGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141270728 16:82538853-82538875 CTTTATGGGGAGAAACAGTGTGG + Intergenic
1141589948 16:85061795-85061817 CTGGGTGGGAAGAAGCAGTGGGG + Intronic
1141799595 16:86297875-86297897 CTCTGTCTGCAGAAGCAGATTGG + Intergenic
1142702657 17:1673557-1673579 CTCTGTGGGCAGAGGCCGGGCGG - Exonic
1142737383 17:1909833-1909855 CTCCGTGTGCAGGAGCAGAGTGG + Intergenic
1142791136 17:2266989-2267011 TTCTGTGGGAAGAAGCAGATTGG - Intronic
1143724389 17:8835455-8835477 CTCTGAGGGCAGAAGCAGAGGGG + Exonic
1143964254 17:10745347-10745369 ATGTGTGGACAGAAGCAGGGGGG - Intergenic
1146254937 17:31386425-31386447 TTCTGTGAGCAAAAGCAGAGAGG - Intergenic
1146279878 17:31538109-31538131 CTTTTGGGGCAGAAGCAGGTTGG - Exonic
1146930831 17:36776731-36776753 CTATGTGGGTAGGGGCAGAGGGG + Intergenic
1147241097 17:39091050-39091072 CTGTGGGGGCAGCAGAAGAGAGG - Intronic
1147769618 17:42858480-42858502 TTTTCTGGTCAGAAGCTGAGTGG - Intergenic
1151908701 17:77066896-77066918 CATGGTGGGCAGAGGCAGGGCGG - Intergenic
1151934933 17:77255706-77255728 CTTTCAGGGCAGAGGCAGGGTGG + Intergenic
1152234577 17:79132081-79132103 CTTGGTCGGCAGGTGCAGAGCGG + Intronic
1203174554 17_GL000205v2_random:184845-184867 TTCTGTGGGCATAAGCACAGTGG + Intergenic
1153560030 18:6362429-6362451 CTCTGTTAGCAGAAGGAGAGAGG - Intronic
1153807420 18:8721483-8721505 GGGTGGGGGCAGAAGCAGAGAGG - Intronic
1154031698 18:10758841-10758863 CTTTGTGGGCAGTTGCTGGGAGG - Intronic
1155596737 18:27496593-27496615 TTTTATGGGGAGAAGCAGATTGG + Intergenic
1156777512 18:40810625-40810647 CTTTATGAGCAGAAGTGGAGGGG + Intergenic
1156951221 18:42900733-42900755 CTTTGTAGGCTGAGGCAGAAGGG + Intronic
1157198406 18:45638922-45638944 CTTTGAGGGCAGAAAAAGAAAGG - Intronic
1157303768 18:46501214-46501236 ATTTGTGGACATATGCAGAGTGG + Intronic
1158495599 18:57952576-57952598 CTTTGTGGGCTGCGGCAGCGTGG + Intergenic
1159871279 18:73761872-73761894 CCCTGTGGGCAGGAACAGAGAGG + Intergenic
1160730701 19:640529-640551 GTGTCTGGGAAGAAGCAGAGGGG - Intronic
1162560530 19:11415872-11415894 CTGTGTGGGAAGAAGCAGACAGG + Intronic
1163641815 19:18466386-18466408 CTTTGTGGGGGGATGCTGAGAGG - Intronic
1164071268 19:21770585-21770607 TTTTATTGGCAGAAGCACAGTGG + Intergenic
1164547715 19:29182991-29183013 CCTACTCGGCAGAAGCAGAGAGG - Intergenic
1165246852 19:34502906-34502928 GTTTGAGGGAGGAAGCAGAGAGG - Exonic
1165649607 19:37474346-37474368 CATTGTTAGCAGGAGCAGAGAGG + Intronic
1166251760 19:41576283-41576305 CTCTGTGGGGACAAGCTGAGGGG - Exonic
1166281405 19:41796686-41796708 CTCTGTGGGGAGAGGCTGAGGGG - Exonic
1167160310 19:47763250-47763272 CTTTGTGGGAAAAAGCAAACAGG + Intergenic
1167283656 19:48586442-48586464 CTCTGTATCCAGAAGCAGAGAGG + Intronic
1168078742 19:53994052-53994074 GTCTGTGGGCACATGCAGAGTGG - Intronic
925357258 2:3250583-3250605 CTTTGAGGGCAGAAGCAGAATGG + Intronic
925615419 2:5740615-5740637 CTTTGAGAGCAGAAGGTGAGCGG - Intergenic
925615891 2:5744221-5744243 CTTTGTGGGCAGGAGCACCTCGG + Intergenic
927860767 2:26558689-26558711 CTCTGTGGGCAGCATCGGAGGGG - Exonic
928130962 2:28649704-28649726 CTCTGTGGGCAGAAAAAGGGAGG + Intergenic
929300248 2:40295904-40295926 CTTTGTGAGCAGGAGGAGAAGGG + Intronic
929300587 2:40299704-40299726 CTATTTGGGCAGAGGCAGATGGG - Intronic
929929253 2:46239447-46239469 CCTTGAGGACAGAAGTAGAGAGG + Intergenic
931435322 2:62240870-62240892 CTTTGAGGAGAGAGGCAGAGGGG + Intergenic
931874213 2:66494782-66494804 CTTTGTGGGTAGAAGAAGGAAGG + Intronic
932432654 2:71685174-71685196 CGCTGTGGGCAGAAGCAGAGTGG + Intronic
933351523 2:81158473-81158495 CTTTGTGGAAAGAGACAGAGTGG - Intergenic
934092766 2:88567783-88567805 CTATGGGGGCAGTGGCAGAGGGG - Intronic
936153322 2:110033303-110033325 CAGTGTGGGCAGCAGCATAGTGG + Intergenic
936191359 2:110338112-110338134 CAGTGTGGGCAGCAGCATAGTGG - Intergenic
936482439 2:112897253-112897275 CTCGGTGGGATGAAGCAGAGTGG - Intergenic
937240738 2:120460870-120460892 CTTTTTGGGGAGAAGTAGAAAGG - Intergenic
939551441 2:143620565-143620587 CTTGGCTGGCAGAAGCAGAAAGG - Intronic
939568959 2:143817580-143817602 TTTTCTGGGGAAAAGCAGAGGGG + Intergenic
941883592 2:170505827-170505849 GTGTGTGGGGAGAAGCAGTGAGG - Intronic
942489014 2:176471074-176471096 CGTTGTGGGTAGATGCAGATAGG - Intergenic
943663371 2:190583179-190583201 CTTGATGGGCAGAAGGAGAGAGG + Intergenic
944493186 2:200279015-200279037 CTTTGTGGGTACAATCAGGGAGG - Intergenic
945507207 2:210656583-210656605 TTGTGTGGGCAGCATCAGAGTGG - Exonic
945976486 2:216275133-216275155 ATTTATTGGGAGAAGCAGAGTGG - Intronic
946184790 2:217974393-217974415 CTTTCTGGGGAGAGGCTGAGGGG - Intronic
947544275 2:231000343-231000365 CTGTGGGGACAGAAGGAGAGAGG - Intronic
947592835 2:231395301-231395323 CTTTGGGGCCAGAGGCAGACAGG - Intergenic
948561904 2:238859920-238859942 CTCTGGGGGCCGAGGCAGAGAGG + Intronic
948806368 2:240455047-240455069 CTTAGTGAGGAGCAGCAGAGTGG + Intronic
1169023923 20:2351270-2351292 CTTGGTGAGCAGAGGCACAGGGG + Intergenic
1169896370 20:10509106-10509128 CGTTGTGGGTAGAATCACAGGGG - Intronic
1170320371 20:15090574-15090596 CTCTGGGGGAAGAAGAAGAGAGG + Intronic
1170704509 20:18733176-18733198 CTCAGTGGGCAGAAGGAGGGTGG + Intronic
1171331171 20:24340017-24340039 ATTTGAGTGCAGAAGCAGACTGG - Intergenic
1173085421 20:39911531-39911553 ATTTGAGGGGAGAACCAGAGTGG + Intergenic
1173238022 20:41266232-41266254 CTTCATAGGTAGAAGCAGAGTGG + Intronic
1174340303 20:49891147-49891169 CTGTGTGGGGAGAAGCTCAGTGG + Exonic
1174580950 20:51571066-51571088 CTCTGTGGGTAGAAGAAGCGGGG + Intergenic
1176007298 20:62873103-62873125 TGTGATGGGCAGAAGCAGAGGGG + Intergenic
1176332879 21:5565467-5565489 TTTTGTGGGCATAAGCACAGTGG + Intergenic
1176394878 21:6255485-6255507 TTTTGTGGGCATAAGCACAGTGG - Intergenic
1176442279 21:6733620-6733642 TTTTGTGGGCATAAGCACAGTGG + Intergenic
1176466541 21:7060689-7060711 TTTTGTGGGCATAAGCACAGTGG + Intronic
1176490102 21:7442467-7442489 TTTTGTGGGCATAAGCACAGTGG + Intergenic
1177206131 21:18014047-18014069 CTTTGTGGGCACAAGCTGATAGG + Intronic
1178432526 21:32529179-32529201 CTTTGTGGACAGCAAGAGAGCGG - Intergenic
1179725520 21:43339503-43339525 CCTTGTAGGCAGAGGCTGAGGGG - Intergenic
1181962472 22:26632700-26632722 ATTTGTGGGCAGAGGAAGATGGG - Intergenic
1182773175 22:32810626-32810648 CCTCATGGGCAGAGGCAGAGGGG - Intronic
1184074036 22:42164853-42164875 CTGTGTGTGCAGAAGCCCAGAGG + Intronic
1184662879 22:45973509-45973531 CTTTGGGGCCAGAAGCAGAGGGG - Intronic
1184778038 22:46633033-46633055 CTGAGTGGGCAGAGGCAGATGGG + Intronic
1184889121 22:47368737-47368759 CTTTGTGGGCAGTACATGAGAGG - Intergenic
1185051265 22:48555531-48555553 CTTTATGGGAAGAGGGAGAGAGG + Intronic
1185204657 22:49530905-49530927 CTCTGTGCCCAGATGCAGAGTGG - Intronic
950180181 3:10906529-10906551 CTTTGGGGGTAGAAGCTTAGTGG + Intronic
950820481 3:15753070-15753092 CTCTGTGGGCAGTGGCAGTGAGG + Intronic
952506581 3:34012068-34012090 TTTTCTTGACAGAAGCAGAGAGG + Intergenic
952627414 3:35423433-35423455 ATTTGTGGGGAGAAACAAAGTGG - Intergenic
955520486 3:59770873-59770895 CCTCCTGGGCAGAAGCAGAGTGG - Intronic
955638893 3:61060475-61060497 CTTTCTGGGAAAAAGCACAGAGG + Intronic
957193890 3:77042766-77042788 CTTTGGGGGCAGGAGAAGGGTGG - Intronic
957593047 3:82225295-82225317 CGCTGTGGGCAGTAGCAGAGAGG + Intergenic
958102249 3:89027645-89027667 CTTTTTGGGCAGATGCATAAAGG - Intergenic
958148386 3:89657587-89657609 TAAAGTGGGCAGAAGCAGAGTGG + Intergenic
961077820 3:123998105-123998127 CTGTGTGAGGAGAGGCAGAGGGG - Intergenic
961306750 3:125963230-125963252 CTGTGTGAGGAGAGGCAGAGGGG + Intergenic
961636136 3:128334291-128334313 CTCCTGGGGCAGAAGCAGAGAGG - Intronic
962740680 3:138360905-138360927 ATTTGAGGGCAGATGAAGAGGGG + Intronic
962950169 3:140211166-140211188 CTCTGTGCTCAGTAGCAGAGTGG + Intronic
963374382 3:144445130-144445152 ATTTGTAGGCAGGAGCACAGGGG + Intergenic
963758349 3:149259291-149259313 GTGTGTGGGCACCAGCAGAGTGG - Intergenic
963827169 3:149969202-149969224 CTTTCTGGGCAAACGCAAAGTGG + Intronic
963961389 3:151313177-151313199 CTGTGCAGGCAGTAGCAGAGCGG - Intronic
965553544 3:169996534-169996556 CTTTGTGGGCAAGAGCAGAGTGG - Exonic
966921536 3:184614948-184614970 CAAGGTGGGAAGAAGCAGAGAGG - Intronic
967036466 3:185651970-185651992 CTTGGTGGGCAGCAGCAGGGAGG + Intronic
967529930 3:190537311-190537333 CTGTGTGGCAAGAAACAGAGAGG - Intronic
968279673 3:197466863-197466885 TTTTAAGGGCAGAGGCAGAGAGG + Intergenic
968451939 4:679997-680019 CTGTTTGGGGAGAAGCTGAGCGG + Exonic
968490296 4:886510-886532 CATTGTGGGGACAGGCAGAGTGG - Intronic
968661906 4:1802132-1802154 CTTCGGGGGCAGAAGCTGTGGGG + Intronic
968986027 4:3874866-3874888 CTTGGTGGGGAAAACCAGAGAGG + Intergenic
969883736 4:10196946-10196968 TTTTGTGGGCATAGGCACAGTGG - Intergenic
971252386 4:24984273-24984295 ATTCTTGGGCTGAAGCAGAGGGG - Intergenic
972259006 4:37389241-37389263 CACTGTGGGGAGAAACAGAGTGG - Intronic
974040392 4:56852392-56852414 CTTGGCAGGCTGAAGCAGAGAGG - Intergenic
974070880 4:57122395-57122417 GTTTGTGAGCAGAACCAAAGTGG - Intergenic
974910337 4:68110113-68110135 CTTTTTGGCAAGAAGTAGAGAGG - Intronic
975114134 4:70660191-70660213 CTATGTGGGCAGGATCTGAGTGG + Intronic
976104406 4:81601387-81601409 ATATGTGGGTAGAACCAGAGGGG - Intronic
976770836 4:88651061-88651083 TTTTGTGGGGAGAGGAAGAGTGG + Intronic
978620298 4:110630139-110630161 CGTTGGGGGCAGAGGCGGAGAGG + Intronic
979000685 4:115214485-115214507 CTGTGTGGGCAGAGGCTGTGAGG - Intergenic
980472893 4:133272529-133272551 CTTCTTGGGCAGTAGCATAGTGG - Intergenic
980520810 4:133931811-133931833 CCATGGGGGCAGAAGGAGAGGGG - Intergenic
983992236 4:174134374-174134396 CTTTGTGGGCAAGTGAAGAGAGG - Intergenic
985421122 4:189786140-189786162 CTTTCTGGGAACAAGGAGAGAGG - Intergenic
986397611 5:7345713-7345735 CTTGAAGGGCAGAAGCGGAGGGG - Intergenic
987313424 5:16701835-16701857 CTTCCTGGACAGAAGCAGAAGGG + Exonic
988520283 5:31939449-31939471 CTGTGTGGCCAGATGCAGTGAGG + Intronic
988779070 5:34502788-34502810 CCATGTTGGCAGAAGCCGAGAGG - Intergenic
989411757 5:41127397-41127419 CTTTGGGGTCAGAAGCAAAGAGG + Intergenic
990373440 5:55144808-55144830 CTCTGTGGACAGAACCTGAGAGG - Intronic
991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG + Intergenic
991215132 5:64151434-64151456 CTTTGTTGGCAGATGGGGAGGGG - Intergenic
991414559 5:66379141-66379163 CATTGTAGGCAGAAGGAGAGGGG + Intergenic
991645358 5:68795627-68795649 CTTTGGAGGAAGAGGCAGAGAGG - Intergenic
991651982 5:68865097-68865119 GAGAGTGGGCAGAAGCAGAGTGG + Intergenic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
994409226 5:99385169-99385191 CTTTTTGGGGAGAAGCACATAGG + Intergenic
996313454 5:122134192-122134214 CTATGTTGGGAGCAGCAGAGAGG + Intronic
997992940 5:138561256-138561278 CTTTAGGGGCAGTAGCAGGGAGG - Intronic
998327915 5:141298366-141298388 TTTTGTGGGCAGGGGCACAGTGG - Intergenic
999121618 5:149214189-149214211 CTTTTTGGGCTGCAACAGAGAGG + Intronic
999371647 5:151059009-151059031 CTTTGTGGAAAGAGGCAGTGGGG - Intronic
999491787 5:152058345-152058367 CTTTTTGGGTAGAAGCAGATTGG + Intergenic
1000138503 5:158379039-158379061 TTTTGTGGTCAGGAGCAGAGAGG + Intergenic
1000805573 5:165786510-165786532 CTAGGTGAGCAGAGGCAGAGAGG + Intergenic
1001303561 5:170555295-170555317 CTTTGGGGGCAGAAGGAATGAGG + Intronic
1001338805 5:170824947-170824969 ATTTGTGGGGAGAAGGAGAGAGG - Intergenic
1001517362 5:172365312-172365334 TTTTGTGGGCAGGAACACAGAGG + Intronic
1001575926 5:172763776-172763798 CTTTCTGGGAAGAGGCAGTGAGG - Intergenic
1001592829 5:172878061-172878083 CTTTGTGGGAAGGAGGGGAGGGG + Intronic
1001896189 5:175383514-175383536 CTTTGTTGGCAGAGTGAGAGTGG - Intergenic
1002152700 5:177248468-177248490 CTTTGTGGGGAGAAAAAAAGGGG - Intronic
1003575348 6:7288509-7288531 CTGTGTGGGCATGAGCATAGGGG + Exonic
1006577544 6:35057317-35057339 CTTTGTTGACAGAGCCAGAGTGG - Intronic
1006814231 6:36839751-36839773 GTCTGTGGGCAGAGGTAGAGGGG + Exonic
1007658696 6:43468964-43468986 GATTGTGGGCAGGAGCAGGGAGG + Intergenic
1011226948 6:85118225-85118247 CTTGGAGGGCAAAAGCATAGAGG - Intergenic
1016331114 6:142952717-142952739 CTTTTTAGGCAGAAGCTGGGTGG + Intergenic
1017617727 6:156262881-156262903 CTGTCTGGGCCAAAGCAGAGAGG + Intergenic
1017754808 6:157520244-157520266 CATTGTGGGCAAGAGCAGAGGGG - Intronic
1018016081 6:159713537-159713559 CTTTCAGGGCAGAAGCACAGGGG - Intronic
1018246378 6:161828503-161828525 CCCTTTGGGCAGAAGCACAGTGG - Intronic
1018475442 6:164135607-164135629 CTTTCTGGGGAGAAGGGGAGAGG + Intergenic
1018508163 6:164493937-164493959 CTTCGTGAGCAGAACCAGGGTGG - Intergenic
1018902230 6:168057405-168057427 CTCTGTGGCCACAAGCAGTGTGG - Intronic
1019131879 6:169882955-169882977 CATTCTGGGCAGAAGCAGTGAGG + Intergenic
1019317010 7:391484-391506 CTGTGTGTGCAGAAGCAGCCAGG + Intergenic
1019353156 7:564583-564605 ATTTGTGTGCAGAGGCACAGAGG - Intronic
1019491374 7:1315041-1315063 AATTGGGGGCAGAGGCAGAGGGG + Intergenic
1019696911 7:2451314-2451336 CATTGTGGCCAGAATCAAAGAGG - Intergenic
1022339453 7:29454662-29454684 ATTTTTGGGCAGAAGCAGCAGGG - Intronic
1022573939 7:31479771-31479793 CTTTGTAGGAAGAGGAAGAGAGG + Intergenic
1022854073 7:34298368-34298390 CTTTGTGGGAAGAAGGTGGGAGG - Intergenic
1023230291 7:38020698-38020720 CTTTGAGGGAAGAGGCAAAGAGG - Intronic
1023269807 7:38450323-38450345 CTTTGTGTCCAGTGGCAGAGAGG - Intronic
1023460655 7:40392859-40392881 CTTTGGGTGATGAAGCAGAGAGG + Intronic
1025771861 7:64515785-64515807 TTTTGTGGGCATAAACACAGTGG + Intergenic
1025819423 7:64948063-64948085 CTTTTTGAGCTGAAGCATAGGGG - Intergenic
1028419856 7:90620760-90620782 ATCTGTGGGCACAAGCTGAGGGG + Intronic
1029138054 7:98389078-98389100 TTTTGTGGCCAGAAACAGATTGG + Intronic
1032745636 7:134783497-134783519 GTTTGGGGTGAGAAGCAGAGTGG - Intronic
1033437677 7:141348390-141348412 TTTTTTGGGGAGAAGCAGCGTGG + Intronic
1035458375 7:159023961-159023983 CTGTGTGGAGAGAAACAGAGAGG - Intergenic
1035696496 8:1601665-1601687 GTTTGTGGGCCGAGGCGGAGAGG - Intronic
1038695782 8:29805104-29805126 CTCTGTGTGCAGCAGCACAGGGG - Intergenic
1038729299 8:30112982-30113004 CTTTTTGGCCAGGTGCAGAGTGG + Intronic
1040342544 8:46448273-46448295 CTGGGTGGGCAGAAACATAGGGG - Intergenic
1041788761 8:61667240-61667262 CTTTGTGGGTAGAGGCATGGGGG - Intronic
1041966591 8:63685581-63685603 CTTCGTGGCCAGAGGCAGGGTGG + Intergenic
1042059978 8:64806037-64806059 CTGTGTTCTCAGAAGCAGAGAGG - Intergenic
1043983485 8:86667379-86667401 CTGTGTGGACAGACTCAGAGGGG - Intronic
1047401163 8:124548754-124548776 CAGTGGGGGCAGATGCAGAGAGG + Intronic
1047495255 8:125404512-125404534 GTTGGTGGGGAGAAGCAGAGGGG + Intergenic
1047950824 8:129933248-129933270 GTTTGGGGGTAGGAGCAGAGAGG - Intronic
1050546216 9:6711446-6711468 CTTTATGATCAAAAGCAGAGTGG - Intergenic
1050987085 9:12096103-12096125 CTTTTAGGGCAGAAGTACAGTGG - Intergenic
1053100928 9:35371790-35371812 TTTAGTGGACAGAAGCAGAGTGG + Intronic
1056754823 9:89375099-89375121 CTTTGCGGGCAGATGCAGGCAGG - Intronic
1058438372 9:104985247-104985269 CTTTGTAGCTAGCAGCAGAGGGG + Intergenic
1058644184 9:107115452-107115474 TTTTGTGGGGATAAGCAGGGTGG + Intergenic
1059353388 9:113681821-113681843 CTCTGTGGGAAGAAAAAGAGGGG + Intergenic
1059399288 9:114058912-114058934 CTTTCTGGGCAGAAGCAGGTGGG - Intergenic
1059740689 9:117146557-117146579 ATGAGTGGGAAGAAGCAGAGAGG + Intronic
1060004006 9:119983608-119983630 CTGTGTGGGCAGAACCTAAGAGG + Intergenic
1060115469 9:120936720-120936742 CCTTGTGGGCAGTTGCAGATGGG + Intergenic
1060540718 9:124428482-124428504 CTTCTTGGGGAGAAGCAAAGAGG + Intergenic
1061266416 9:129507873-129507895 CTCTTTGGCCAGCAGCAGAGGGG - Intergenic
1061824653 9:133250561-133250583 CTTTCTGGACAGAAGCAATGTGG - Intronic
1061922417 9:133789340-133789362 CTTGCTGGGAAGAAGGAGAGGGG + Exonic
1061953734 9:133950755-133950777 GCTTGTGGGCTGCAGCAGAGAGG - Intronic
1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG + Intronic
1203429209 Un_GL000195v1:74816-74838 TTCTGTGGGCATAAGCACAGTGG - Intergenic
1185734384 X:2485941-2485963 ATTTGTTGGCTGAAGAAGAGAGG + Intronic
1187883292 X:23865650-23865672 CTTTGAGGGCAGCAGCAGGGTGG - Intronic
1188043066 X:25393040-25393062 ACCTGTGGACAGAAGCAGAGAGG - Intergenic
1188296365 X:28454997-28455019 ATTTGTGGGCATATTCAGAGTGG - Intergenic
1189365954 X:40388718-40388740 ATTTGTGGACACATGCAGAGTGG - Intergenic
1190881048 X:54493002-54493024 CTTTTTGGGGAGGAGGAGAGTGG + Intronic
1191077343 X:56469143-56469165 CTGTGTGGGCAGATGGGGAGGGG - Intergenic
1192125292 X:68496136-68496158 CTTTGAGGGTAGGAGAAGAGGGG + Intergenic
1195549034 X:106145338-106145360 CTTTGTGGGCATGGGCACAGTGG + Intergenic
1198119969 X:133582778-133582800 CTGTGTGGGCAGAATCAGAAGGG + Intronic
1200228548 X:154432595-154432617 CTGTGTGGCCAGAAGAGGAGGGG + Intronic
1201477859 Y:14403426-14403448 CTTGGAGGGCAAGAGCAGAGAGG - Intergenic
1201514277 Y:14800475-14800497 CTTTGGGGACAGGAGAAGAGGGG + Intronic