ID: 923290743

View in Genome Browser
Species Human (GRCh38)
Location 1:232543192-232543214
Sequence ACCTAGGTGAAAGTACAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923290743 Original CRISPR ACCTAGGTGAAAGTACAGTA AGG (reversed) Intronic
908530110 1:65026242-65026264 ACATAGCTGAAATTACAGTTTGG - Intergenic
909038046 1:70617437-70617459 ACTTATGTGAAAGAACAGAAAGG + Intergenic
911517885 1:98890314-98890336 TCCTTTGTGAAAGAACAGTAGGG - Intronic
911993303 1:104730625-104730647 ACCCAGGTAGAAGTACAGTTGGG + Intergenic
923290743 1:232543192-232543214 ACCTAGGTGAAAGTACAGTAAGG - Intronic
924472700 1:244357250-244357272 ACATAAGTAAACGTACAGTATGG + Intronic
1063518185 10:6717072-6717094 GCCTAGCTGGAAGTACTGTATGG + Intergenic
1064880360 10:20045104-20045126 ACCTTGGTGAAAGAAAAGAAAGG - Intronic
1066585770 10:36933247-36933269 CCATAGTTGCAAGTACAGTAAGG - Intergenic
1068576884 10:58694190-58694212 ACAAAGGTGAAAGTGCAGCAAGG - Intronic
1069020762 10:63485891-63485913 ACCAAGTTGACAGCACAGTAGGG + Intergenic
1073385291 10:103122130-103122152 ACCTAGGTGGGAGTGCAGTGGGG - Intronic
1073969547 10:109031668-109031690 ACCTAGATGAAAATGCAGAAGGG + Intergenic
1074610440 10:115016399-115016421 ACCCAGGTTGGAGTACAGTAGGG - Intergenic
1078841878 11:15084771-15084793 ACTTAGGGGAAAGTGCAGAAGGG - Intergenic
1078952398 11:16148927-16148949 AACTATGTAAAAGTACAGAAGGG - Intronic
1081026333 11:38019443-38019465 GCCTGGGGGAAGGTACAGTATGG - Intergenic
1081425219 11:42919197-42919219 GCCTGTGTGAAAGTACAGAAGGG - Intergenic
1081976096 11:47235796-47235818 ACCCAGGTGGGAGTACAGTGGGG + Intronic
1082127789 11:48453414-48453436 ACCTGGGGGAAGGTACAGCAGGG - Intergenic
1085374991 11:76052341-76052363 ACACAGGTGAGAGTACAGAAGGG - Intronic
1085902394 11:80716917-80716939 CCATAGATGCAAGTACAGTAGGG + Intergenic
1087657689 11:100945039-100945061 ACTTAGCTGACAGTGCAGTAGGG - Intronic
1088231219 11:107675482-107675504 ACCTAGCTGGAAGTAAAGTCAGG - Intergenic
1088783637 11:113161150-113161172 ACCTAGGAGAAAAGAGAGTAGGG + Intronic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1094467558 12:30769754-30769776 ATCTAGGTGAAAATTCAGGAAGG + Intergenic
1097247118 12:57612735-57612757 CCCTGGGAGAAAGCACAGTAAGG - Intronic
1098124376 12:67274886-67274908 ATATAGCTGAAAGTACAGTGTGG + Intronic
1104626032 12:130355651-130355673 ACCAAGGTGGAAAAACAGTAAGG + Exonic
1104941454 12:132397394-132397416 ACCCAGGTGAAAGCCCAGGAGGG - Intergenic
1105870220 13:24497908-24497930 TCCAAGGTCAAAGTACAGCAGGG - Intronic
1108489236 13:50963795-50963817 AGATAGGTGAAAGTACAATAAGG - Intronic
1109673596 13:65641974-65641996 ACCTAGGTTGGAGTGCAGTAGGG - Intergenic
1111255340 13:85660560-85660582 ACCTAGATGAAAGTACAAAGGGG - Intergenic
1111573654 13:90120368-90120390 ACCTATGTGGAAGAACAGTTTGG + Intergenic
1111735336 13:92131777-92131799 ACCTATGTGAAAATTCAATAAGG + Intronic
1111888741 13:94055145-94055167 ACCTAGGTGAGAGAAAAGCAGGG + Intronic
1112737142 13:102433273-102433295 ACTTAGGAGAAGGTACAGCAGGG + Intergenic
1117695097 14:58353731-58353753 ACCAAAGTGAAAGTAAAATATGG + Exonic
1118373225 14:65155351-65155373 ACAGAGATGAAAGTACAGCAGGG + Intergenic
1123020031 14:105393371-105393393 ACGTAGGTGAGAGCACAGCAAGG + Intronic
1128555797 15:68630970-68630992 ACCTAGGAGGAAGTCCACTAGGG - Intronic
1131293311 15:91125878-91125900 AGTTAGGTTCAAGTACAGTAGGG - Intronic
1134560976 16:15209229-15209251 ACCAATGTGAAAATACAGGAAGG - Intergenic
1150665212 17:67128474-67128496 ATGTAAGTGAAAATACAGTATGG - Intronic
1153387424 18:4513032-4513054 ACCAATGTCAAATTACAGTAAGG + Intergenic
1153531382 18:6050025-6050047 ACATAGGTGAGAGTTCAGGAAGG + Intronic
1156382616 18:36577969-36577991 ACCAAGGTTAAAGTGCTGTACGG + Intronic
1156925287 18:42570024-42570046 TCCTAGTTGAAAGTAAAGCAAGG + Intergenic
1165181651 19:33976818-33976840 ACTTAGCAGGAAGTACAGTAAGG - Intergenic
928852252 2:35762834-35762856 ACTGAGGTAAAAGTACATTAGGG - Intergenic
930215681 2:48694244-48694266 AACAATGTGAAAGCACAGTAAGG - Exonic
930559424 2:52942082-52942104 GCTTATGTGAAAGTACAGGATGG - Intergenic
935548911 2:104430852-104430874 GCCTGGGTGAGAGGACAGTAGGG + Intergenic
939609811 2:144296775-144296797 ACCTGGGTGAAAGTGTAGTCTGG - Intronic
941167064 2:162093876-162093898 CCCTAGGTTACAGAACAGTAGGG - Intergenic
941675136 2:168336063-168336085 ACCAAGTTGAAAATACAGCAAGG - Intergenic
945640997 2:212429607-212429629 ACCTACCTGAAAATACTGTAAGG - Intronic
946291152 2:218746356-218746378 ACAGAGGAGAAAGTACAGGACGG + Intronic
946547218 2:220757377-220757399 ACCTAGGTAAAAATACTGAATGG + Intergenic
947621618 2:231594480-231594502 ACCTGGGTGGAGGTTCAGTAGGG - Intergenic
1169121381 20:3098258-3098280 ACCCAGGTTGGAGTACAGTAGGG - Intergenic
1174468247 20:50734009-50734031 AGTTAGCTGAAAGTGCAGTATGG - Intronic
951413795 3:22397819-22397841 ACCTACGTGAAAAAAAAGTAGGG - Intergenic
953182012 3:40604618-40604640 ACATAGGTGTAATTACAGAAGGG + Intergenic
958148524 3:89658429-89658451 ACCCAGGTGAAAATGCAGTCTGG + Intergenic
966527387 3:180934394-180934416 ACCTATGAGAAATTAGAGTAGGG + Intronic
967804024 3:193698137-193698159 ACCTAGTTTAAAATAAAGTATGG - Intergenic
969174962 4:5391537-5391559 ACCTGGGTCAGAGTTCAGTAGGG + Intronic
969643884 4:8415040-8415062 ACCTTGGGGAAAGTGCAGTGTGG - Intronic
974230286 4:59104161-59104183 ACCCATGAGAAAGTACAGTTTGG + Intergenic
976486790 4:85615254-85615276 TCTTAGGTGAAAGAAAAGTAGGG - Intronic
977654201 4:99503308-99503330 AACTAGGTGAAAGGAGAGAAGGG - Intergenic
978695949 4:111579476-111579498 ACAAAGATGAAAGTACAGCAAGG + Intergenic
979305631 4:119139821-119139843 ACCCAGGTGAGAGGACTGTAGGG - Intronic
979596538 4:122541214-122541236 ACCTAGTTGGAAGCATAGTATGG - Intergenic
980099505 4:128527604-128527626 ACCCAGGTGAAAGTAATCTATGG + Intergenic
983891738 4:173036742-173036764 ACCTAGTTAAAAGCACAGAAAGG + Intronic
984261422 4:177447035-177447057 ACCTAGGTAATAGTTCAGTGGGG - Intergenic
985344270 4:188986485-188986507 ACTTAGTTTAAAATACAGTAGGG - Intergenic
991954994 5:71985504-71985526 ACTTAGGTGAATGTACACTGGGG + Intergenic
992673789 5:79085046-79085068 ACCTTGATGATAGTAAAGTATGG - Intronic
994969944 5:106723517-106723539 ACTTTTGTGAAACTACAGTATGG + Intergenic
997140519 5:131375440-131375462 ATCTAAGTCAAAGTACAGAAAGG - Intronic
998232446 5:140369613-140369635 AGCTGGGTGAAAGTGGAGTAGGG + Intronic
1000523194 5:162322508-162322530 ACCTAGGAGAAAATCAAGTAGGG - Intergenic
1004111404 6:12722119-12722141 GCCAACTTGAAAGTACAGTATGG + Intronic
1006713425 6:36096125-36096147 ACCCAGGTCAAAGTACAGATTGG - Intronic
1012966462 6:105679490-105679512 ACCTTGTGGAAAGCACAGTAAGG + Intergenic
1019254872 7:43151-43173 TCCAAGGCGAAAGTAAAGTAGGG + Intergenic
1020398738 7:7749309-7749331 ACCTCAGTGAGAGTACAGTATGG + Intronic
1020436772 7:8172999-8173021 ACGGAGGTGAAAGTAAAATAGGG + Intronic
1024151833 7:46579481-46579503 ACCTAAGTGAAAGTAGAAAATGG + Intergenic
1027108688 7:75421012-75421034 ACCTAGGCCAGAGTACAGTGTGG + Intronic
1031500385 7:122507333-122507355 ATCTAGGTGGAAGAAAAGTAAGG + Intronic
1036035399 8:5013179-5013201 ATCTAGGGGAAAGTAAAGGAGGG - Intergenic
1036489036 8:9207406-9207428 ACCTAGATGAAAGTGCAAAACGG - Intergenic
1045071887 8:98514793-98514815 AGATAGTTGAAAGTACAGAATGG - Intronic
1051628114 9:19117493-19117515 AACTAGGTGAAAGGGCAATAAGG - Intronic
1051770992 9:20579642-20579664 TCCTATGAGAAAGTAAAGTATGG + Intronic
1055588934 9:77789147-77789169 ATCTGGATGAAAGGACAGTAAGG - Intronic
1059868961 9:118549597-118549619 GCCTACTTGAAAGTAGAGTATGG + Intergenic
1060533856 9:124367191-124367213 AGCCAGGTGAAAGTGCAGGATGG + Intronic
1061030267 9:128077562-128077584 ATTTAGGTGAAAGTCCAGAATGG + Intronic
1191933839 X:66404913-66404935 TCCCAGGGGAAGGTACAGTATGG + Intergenic
1192405542 X:70882358-70882380 ACCTAGGCTGAAGTACAGTGGGG + Intronic
1196100360 X:111841347-111841369 CCCTAGGTAAAAGTACAGACTGG + Intronic
1198439732 X:136651427-136651449 ACCTCGGTGACAGTACAGGAGGG - Intronic
1198988866 X:142487767-142487789 AGATAGGTGAAAGTACAAAATGG - Intergenic
1201283716 Y:12361756-12361778 ACCTGGGTGATAGTACCCTAAGG - Intergenic