ID: 923292736

View in Genome Browser
Species Human (GRCh38)
Location 1:232562178-232562200
Sequence CCACTCTGTAAGGACAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 373}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923292736_923292739 11 Left 923292736 1:232562178-232562200 CCAGGCTTGTCCTTACAGAGTGG 0: 1
1: 0
2: 0
3: 18
4: 373
Right 923292739 1:232562212-232562234 ACTGCACATTTTGAATGCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 172
923292736_923292740 14 Left 923292736 1:232562178-232562200 CCAGGCTTGTCCTTACAGAGTGG 0: 1
1: 0
2: 0
3: 18
4: 373
Right 923292740 1:232562215-232562237 GCACATTTTGAATGCCAAGGAGG 0: 1
1: 0
2: 1
3: 27
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923292736 Original CRISPR CCACTCTGTAAGGACAAGCC TGG (reversed) Intergenic
900579079 1:3399488-3399510 CCACTCAGTAAGGGCAGGCCAGG + Intronic
901027542 1:6286564-6286586 CCACTGAGCAGGGACAAGCCAGG + Intronic
902425731 1:16320111-16320133 GCACTCTGGAAGGCCAAGGCAGG + Intronic
903102460 1:21043643-21043665 GCACTCTGTGAGGCCAAGGCAGG + Intronic
903534715 1:24059379-24059401 CCACTCTGGGAGGCCAAGGCAGG - Intronic
904142848 1:28367587-28367609 GCACTCTGGAAGGCCAAGGCTGG - Intergenic
904650129 1:31999241-31999263 GCACTCTGGAAGGCCAAGGCAGG + Intergenic
905130573 1:35753335-35753357 GCACTTTGGAAGGACAAGGCAGG - Intronic
906079339 1:43073908-43073930 CGACTCTAAAAGGACAAGCTGGG - Intergenic
908259631 1:62329616-62329638 GCACTTTGGAAGGACAAGGCAGG + Intergenic
908696912 1:66854143-66854165 GCACTTTGTAAGGCCAAGGCAGG + Intronic
909444207 1:75730139-75730161 CCACTTTGGGAGGACAAGACGGG - Intronic
910513900 1:88036882-88036904 CCACCCAGTAAGGAGAAGTCGGG - Intergenic
914453328 1:147812508-147812530 CCACTCAACAAGGACAAGCTTGG + Intergenic
914794889 1:150911677-150911699 GCACTTTGTGAGGACAAGGCAGG - Intergenic
914876762 1:151518091-151518113 CCACTTTGGAAGGCCAAGGCGGG - Intronic
915376915 1:155404425-155404447 ACACTTTGGAAGGACAAGGCAGG + Intronic
915454025 1:156027416-156027438 GCACTCTGGAAGGCCAAGGCAGG - Intergenic
916063199 1:161116267-161116289 CCACTCTGGGAGGCCAAGGCAGG + Intronic
916183405 1:162107588-162107610 CCACTCTGGGAGGCCAAGGCAGG - Intronic
916519743 1:165552972-165552994 CCACTCAGTAAGGTCAAGATGGG - Intronic
917825684 1:178818112-178818134 GCACTCTGGAAGGCCAAGGCGGG + Intronic
918000674 1:180492053-180492075 GCACTCTGGGAGGCCAAGCCAGG - Intronic
918516706 1:185371077-185371099 GCACTCTGGAAGGCCAAGGCAGG - Intergenic
920017425 1:202924511-202924533 CCACTCTGGGAGGCCAAGGCAGG + Intronic
920193120 1:204207496-204207518 CCACCCGATACGGACAAGCCAGG + Intronic
921040530 1:211427013-211427035 CCACTTTGAGAGGCCAAGCCGGG + Intergenic
921465611 1:215483434-215483456 CCAGTCTGTTAGGACAAACCAGG - Intergenic
922274913 1:224068526-224068548 CCAGACTGTAAGGATTAGCCTGG - Intergenic
922538801 1:226403472-226403494 CCACTCTGTAAAGCCAGGACTGG - Intronic
923292736 1:232562178-232562200 CCACTCTGTAAGGACAAGCCTGG - Intergenic
923575343 1:235153670-235153692 GCACTCTGGAAGGCCAAGGCGGG - Intronic
924871819 1:248055507-248055529 GCACTCTGGAAGGCCAAGGCAGG + Intronic
1063554418 10:7064724-7064746 GCACTTTGGAAGGACAAGGCAGG + Intergenic
1066267459 10:33790331-33790353 CCACTCTGGGAGGCCAAGGCGGG - Intergenic
1066417521 10:35235056-35235078 GCACTCTGTGAGGCCAAGCTGGG - Intergenic
1066573868 10:36803639-36803661 GCACTCTGGAAGGCCAAGGCGGG + Intergenic
1067557027 10:47279623-47279645 CCACTCTGTCAGGTCATGCCTGG - Intergenic
1068670931 10:59722976-59722998 GCACTTTGTAAGGCCAAGGCGGG + Intronic
1068710624 10:60129503-60129525 GCACTTTGGAAGGACAAGCTGGG + Intronic
1069409772 10:68141122-68141144 GCACTCTGGGAGGACAAGGCGGG + Intronic
1072075143 10:91963513-91963535 GCACTCTGGAAGGCCAAGACTGG - Intronic
1073390169 10:103169368-103169390 GCACTTTGGAAGGACAAGGCAGG + Intronic
1073391890 10:103185397-103185419 CCACTCTGGGAGGCCAAGCCAGG + Intronic
1075320403 10:121486945-121486967 CCACTCTTTAAGGACAAATCTGG + Intronic
1075663340 10:124213496-124213518 CCACTCTGGAATGAATAGCCAGG - Intergenic
1076047485 10:127306259-127306281 GCACTCTGGAAGGCCAAGGCAGG - Intronic
1077393123 11:2308911-2308933 CCACCCGGTCAGCACAAGCCTGG - Intronic
1079210322 11:18455448-18455470 GCACTCTGGAAGGCCAAGGCGGG - Intergenic
1080577396 11:33612501-33612523 GCACTCTGGAAGGCCAAGGCAGG - Intronic
1080735867 11:35013042-35013064 GCACTCTGGAAGGCCAAGGCAGG + Intronic
1082089406 11:48077110-48077132 CCACTTTGGGAGGCCAAGCCAGG - Intronic
1082277184 11:50234507-50234529 CCACTTTGGAAGGCCAAGGCAGG + Intergenic
1082284846 11:50307204-50307226 GCACTCTGGAAGGCCAAGGCGGG - Intergenic
1083617578 11:64034274-64034296 CGTCTCTGCATGGACAAGCCTGG + Intronic
1083867946 11:65468351-65468373 GCACTCTGGAAGGCCAAGGCAGG + Intergenic
1084293400 11:68192308-68192330 CCACTCTTTAAAGACAATCTTGG + Intronic
1084366223 11:68701944-68701966 GCACTCTGTGAGGCCAAGGCAGG + Intergenic
1084397495 11:68922638-68922660 CCACTCTGGGAGGCCAAGGCAGG - Intronic
1084681317 11:70668089-70668111 CAACTCTATAAGGACCAGACTGG - Intronic
1089504229 11:118952879-118952901 GCACTCTGGAAGGAGAACCCTGG + Intronic
1089585107 11:119505567-119505589 GCACTTTGAAAGGACAAGGCGGG + Intergenic
1089656554 11:119951255-119951277 CACATCTTTAAGGACAAGCCTGG + Intergenic
1091755576 12:3049277-3049299 GCACTCTGGAAGGCCAAGGCGGG - Intergenic
1092783749 12:12009902-12009924 GCACTCTGAAAGGCCAAGGCGGG - Intergenic
1093729042 12:22546668-22546690 CCACTTTGTGAGGTCAAGGCAGG - Intergenic
1095327821 12:40918780-40918802 CCACTCTGAAAAGAGAAGCGAGG - Intronic
1096496269 12:52041029-52041051 CCACCCTGGAAGGAGAGGCCAGG + Intronic
1097091731 12:56510843-56510865 GCACTTTGTAAGGCCAAGGCGGG + Intergenic
1097197890 12:57254252-57254274 GCACTCTGGAAGGCCAAGGCAGG + Exonic
1099612123 12:84887436-84887458 CCACTATGTAGGGAAATGCCTGG - Intronic
1099959933 12:89387264-89387286 CCACACTGTGAGGACAGGCCTGG - Intergenic
1100019222 12:90049497-90049519 CCATTCTCTAAGGACATGTCAGG + Intergenic
1100200556 12:92293534-92293556 CCACTTTGGAAGGCCAAGGCTGG + Intergenic
1100837879 12:98584429-98584451 GCACTTTGTAAGGCCAAGACTGG - Intergenic
1102214419 12:111150356-111150378 GCACTGTGGAAGGACAAGCTAGG - Intronic
1102383545 12:112487378-112487400 GCACTTTGGAAGGACAAGGCAGG - Intronic
1102511571 12:113419000-113419022 CCACTCTGGGAGGCCAAGGCAGG + Intronic
1103846861 12:123907934-123907956 CCATAGTGTACGGACAAGCCAGG - Intronic
1103941348 12:124502983-124503005 CCACTCCCTAAGGAAGAGCCAGG + Intronic
1106274432 13:28190504-28190526 GCACTCTGGAAGGCCAAGGCAGG - Intronic
1106690192 13:32107049-32107071 CAACTCTGTAAGAATAAACCTGG + Intronic
1108138845 13:47396738-47396760 GCACTCTGGAAGGCCAAGGCAGG - Intergenic
1111703957 13:91724743-91724765 CTACTCTGTAAGGCCAAGGTGGG + Intronic
1113540638 13:111105636-111105658 TCACTCTGGAAGGACAAGGTAGG + Intergenic
1113705566 13:112430578-112430600 CAACTCTGGAAGGAAAAGCAAGG + Intronic
1114475360 14:22990713-22990735 CCACTTTGGAAGGTCAAGGCGGG - Intronic
1114625810 14:24129476-24129498 CCACTCTGGGAGGCCAAGGCAGG + Intronic
1115234956 14:31200397-31200419 GCACTCTGGAAGGCCAAGGCGGG + Intronic
1116880817 14:50166959-50166981 CCACTTTGGAAGGTCAAGGCAGG + Intronic
1118191837 14:63587950-63587972 GCACTTTGGAAGGCCAAGCCAGG - Intergenic
1118425322 14:65654340-65654362 GCACTCTGGAAGGCCAAGGCAGG + Intronic
1119249385 14:73138597-73138619 CCACTCTGGGAGGCCAAGGCGGG - Intronic
1119587300 14:75848389-75848411 ACACTCTGCAAAGGCAAGCCAGG - Intronic
1119726653 14:76925515-76925537 CCACTTTGAGAGGACAAGGCGGG + Intergenic
1119840853 14:77791790-77791812 CCATTCTGTAAGGATAGGGCTGG - Intergenic
1119844792 14:77820960-77820982 CCACTTTGGGAGGCCAAGCCAGG - Intronic
1120780687 14:88482964-88482986 CCACTTTGGAAGGCCAAGGCAGG + Intronic
1120866657 14:89301047-89301069 GCACTTTGTGAGGCCAAGCCAGG - Intronic
1122558848 14:102596809-102596831 GCACTTTGGAAGGACAAGGCGGG - Intronic
1123463930 15:20500002-20500024 CCACTCTGGGAGGCCAAGGCAGG + Intergenic
1123654133 15:22500421-22500443 CCACTCTGGGAGGCCAAGGCAGG - Intergenic
1124220632 15:27847255-27847277 CTCCCCTGTAAGGAGAAGCCTGG + Intronic
1124308040 15:28595617-28595639 CCACTCTGGGAGGCCAAGGCAGG - Intergenic
1124562110 15:30783770-30783792 GCACTCTGTGAGGCCAAGGCAGG - Intergenic
1125125830 15:36219762-36219784 CTCCTCTGTGAGCACAAGCCAGG + Intergenic
1125340880 15:38674054-38674076 CCACTTTGTGAGGCCAAGGCAGG + Intergenic
1125668754 15:41454335-41454357 GCACTCTGGGAGGACAAGGCAGG - Intronic
1125911023 15:43439289-43439311 CCACTTTGGGAGGCCAAGCCAGG + Intronic
1126024783 15:44435321-44435343 CCACTCTGGGAGGCCAAGGCAGG + Intronic
1126146954 15:45483623-45483645 GCACTCTGGAAGGCCAAGGCAGG + Exonic
1127171109 15:56302239-56302261 CCACTTTGTGAGGCCAAGGCAGG + Intronic
1128190277 15:65686947-65686969 GCTCTCTGGAAGGCCAAGCCAGG - Intronic
1128204897 15:65842327-65842349 GCACTCTGGGAGGCCAAGCCAGG - Intronic
1129637972 15:77342653-77342675 GCACTTTGGAAGGACAAGGCGGG - Intronic
1129982157 15:79882957-79882979 GCACTCTGGGAGGCCAAGCCAGG + Intronic
1130348610 15:83070736-83070758 GCACTTTGGAAGGACAAGGCAGG + Intergenic
1131668621 15:94596265-94596287 GCACTTTGGAAGGACAAGGCGGG + Intergenic
1132980866 16:2738109-2738131 CCAGGCTGGCAGGACAAGCCAGG + Intergenic
1133167660 16:3959777-3959799 GCACTCTGTGAGGCCAAGGCAGG + Intronic
1134120534 16:11581009-11581031 GCACTCTGGGAGGACAAGGCAGG - Intronic
1134310719 16:13073035-13073057 GCACTCTGAAAGGCCAAGACAGG - Intronic
1134846913 16:17448119-17448141 CCACTCTGGGAGGCCAAGGCGGG + Intronic
1135520823 16:23176652-23176674 TCACTCTGAAAGGCCAAGGCAGG + Intergenic
1136037570 16:27551636-27551658 GCACTCTGGAAGGCCAAGGCAGG + Intronic
1136110476 16:28061620-28061642 TCACTCTGTGAGGGCCAGCCCGG - Intronic
1139656741 16:68392136-68392158 GCACTCTGGAAGGCCAAGGCGGG - Intronic
1139724304 16:68884154-68884176 GCACTCTGGAAGGACAAGGCAGG - Intronic
1139740730 16:69032937-69032959 CCACTTTGGAAGGCCAAGGCAGG + Intronic
1139889194 16:70237211-70237233 GCACTCTGGAAGGCCAAGTCGGG - Intergenic
1141275851 16:82587681-82587703 GCACTCTGGAAGGCCAAGGCAGG + Intergenic
1141369457 16:83473665-83473687 CCACTCTGTAGGGAGAATTCTGG + Intronic
1141487722 16:84351988-84352010 CCACTTTGGGAGGCCAAGCCGGG + Intergenic
1141928603 16:87185575-87185597 GCACGCTGTAAGAACAGGCCGGG + Intronic
1142061444 16:88032446-88032468 GCACTCTGTGAGGCCAAGGCAGG - Intronic
1142339043 16:89508642-89508664 CTGCTCTGTAAGGCCCAGCCCGG + Intronic
1142417743 16:89952242-89952264 GCACTCTGGAAGGCCAAGGCAGG - Intronic
1143665673 17:8357956-8357978 CCACTCTCTAGGGTGAAGCCTGG + Intergenic
1143852273 17:9821929-9821951 CCACTGTGCCAGGACCAGCCGGG - Exonic
1143979779 17:10858748-10858770 GCACTCTGGAAGGCCAAGGCCGG - Intergenic
1146678797 17:34792313-34792335 GCACTCTGGGAGGACAAGGCAGG + Intergenic
1147766451 17:42839748-42839770 CCACTTTGGGAGGCCAAGCCGGG + Intronic
1148148504 17:45381419-45381441 GCACTCTGGAAGGCCAAGGCAGG - Intergenic
1148262729 17:46197394-46197416 GCACTCTGGAAGGCCAAGGCAGG + Intronic
1148288044 17:46413846-46413868 CCACTCTGGGAGGTCAAGGCAGG - Intergenic
1148310214 17:46631430-46631452 CCACTCTGGGAGGTCAAGGCAGG - Intronic
1148890672 17:50805128-50805150 CCACTTTGGAAGGCCAAGGCGGG - Intergenic
1149895116 17:60423014-60423036 CCACTCTGAAGGGAAAGGCCAGG - Intronic
1150081729 17:62245818-62245840 GCACTCTGGAAGGCCAAGGCGGG + Intergenic
1150738043 17:67756964-67756986 CCACTTTGGAAGGCCAAGGCAGG + Intergenic
1150757885 17:67932448-67932470 CCACTTTGGAAGGCCAAGACAGG + Intronic
1152105142 17:78324344-78324366 CCACTTTGTGAGGGGAAGCCGGG + Intergenic
1153690876 18:7592463-7592485 CCACTCTCTCAGGACTTGCCTGG + Intronic
1153793485 18:8601155-8601177 CCATTTTGTAAGGCCAAGACAGG - Intergenic
1154067034 18:11116860-11116882 GCACTCTGTGAGGCCAAGGCAGG + Intronic
1154383101 18:13870084-13870106 TCACTCTGTAGGGCCATGCCAGG - Intergenic
1155033361 18:22003193-22003215 CCAGTTGGTAAGGACGAGCCAGG + Intergenic
1155146669 18:23089483-23089505 GCACTCTGGGAGGCCAAGCCAGG + Intergenic
1156594634 18:38533510-38533532 CCAGTCTGTAAAGACAAGAAAGG + Intergenic
1158783243 18:60677380-60677402 GCACTCTGGGAGGACAAGGCGGG - Intergenic
1159118051 18:64137376-64137398 GCACTTTGTTAGGACAACCCTGG + Intergenic
1160078351 18:75699914-75699936 GCACTTTGGAAGGACAAGGCAGG - Intergenic
1161181496 19:2886038-2886060 CCACTTTGGGAGGACAAGGCGGG + Intergenic
1162049084 19:8021328-8021350 CCACTCTGAAAACAGAAGCCGGG + Intronic
1162218944 19:9159791-9159813 GCACTCTGGAAGGCCAAGGCGGG - Intronic
1163387339 19:17007919-17007941 CCACTTTGGGAGGACAAGGCGGG + Intronic
1163621186 19:18361383-18361405 GCACTTTGTAAGGCCAAGGCGGG - Intronic
1164117056 19:22232410-22232432 GCACTCTGGAAGGACAAGGCAGG - Intergenic
1164785113 19:30924362-30924384 ACACACAGTAAGGAGAAGCCAGG - Intergenic
1165142602 19:33711116-33711138 GCACTCTGAAAGGCCAAGGCAGG - Intronic
1166551996 19:43671914-43671936 GCACTTTGGAAGGACAAGGCAGG - Intergenic
1167315215 19:48758818-48758840 GCTCTCTGAAAGGACAAGACTGG + Intergenic
1167783245 19:51614378-51614400 CCACTCTGGAAGGCTAAGCTGGG - Intronic
1167914368 19:52728150-52728172 CCACTTTGGGAGGCCAAGCCTGG - Intronic
926270510 2:11362122-11362144 GCACTCTGGAAGGCCAAGGCGGG - Intergenic
926822184 2:16864400-16864422 TCACTTTGTAAGGCCAAGACGGG + Intergenic
931648218 2:64444592-64444614 GCACTCTGGAAGGCCAAGGCAGG + Intergenic
934283974 2:91634735-91634757 CCATTCTGTCAGGGCAATCCCGG - Intergenic
934736895 2:96694154-96694176 CCACCCTGTCAGGAAATGCCTGG + Intergenic
935230167 2:101089101-101089123 CAACTCTGGAAGGCCAAGGCAGG + Intronic
935579099 2:104740894-104740916 CTACTCTGTGAGGAGAAGGCTGG + Intergenic
936345361 2:111671630-111671652 CAACTCTGTGAGGAAAAGCTTGG - Intergenic
936351222 2:111714086-111714108 GCACTTTGTAAGGCCAAGGCAGG + Intergenic
937157097 2:119728762-119728784 ACACTTTGGAAGGACAAGCTGGG + Intergenic
938020819 2:127904589-127904611 GCACTCTGGAAGGAGAAGCAGGG + Intergenic
938047263 2:128132951-128132973 GCACTTTGGAAGGACAAGGCAGG - Intronic
938610572 2:132943821-132943843 CAACTGTGTAAGAACAAGGCGGG + Intronic
938887252 2:135663778-135663800 CCACTCTGGGAGGCCAAGGCGGG + Intronic
939139716 2:138339880-138339902 GCACTCTGGAAGGCCAAGGCAGG + Intergenic
939615860 2:144361696-144361718 GCACTTTGGAAGGCCAAGCCAGG - Intergenic
940190474 2:151035515-151035537 CCACTTTGGAAGGCCAAGGCAGG + Intronic
940705924 2:157105008-157105030 CAATTCTGAAAAGACAAGCCTGG - Intergenic
941077350 2:161020823-161020845 CCACTTTGAAAGGCCGAGCCAGG + Intergenic
941259612 2:163280409-163280431 GCACTTTGGAAGGCCAAGCCAGG - Intergenic
942036609 2:172016369-172016391 CCACTTTGGAAGGCCAAGGCAGG + Intronic
943045546 2:182857372-182857394 GCACTCTGTAAGGCCAAGGTGGG + Intronic
944152978 2:196581818-196581840 GCACTCTGTGAGGACAAGGCAGG + Intronic
946003353 2:216501960-216501982 GCACTCTGGAAGGCCAAGGCAGG - Exonic
946377443 2:219320882-219320904 ACACTCTGGAAGGCCAAGGCGGG - Intergenic
947788761 2:232849614-232849636 GCTCTGTGGAAGGACAAGCCTGG - Intronic
947960514 2:234232694-234232716 GCACTTTGGAAGGACAAGTCAGG - Intergenic
1168827034 20:820832-820854 ACACTCTGGAAGGCCAAGGCGGG - Intergenic
1169373678 20:5048470-5048492 ACACTCTGGGAGGCCAAGCCGGG - Intergenic
1169900602 20:10548483-10548505 GCACTCTGTGAGGCCAAGGCGGG - Intronic
1170886657 20:20345672-20345694 GCACTCTGGGAGGACAAGGCAGG + Intronic
1171229809 20:23475338-23475360 GCACTATGTGAGGGCAAGCCAGG + Intergenic
1171469381 20:25357762-25357784 GCACTTTGGAAGGACAAGGCAGG + Intronic
1171781225 20:29420092-29420114 TCACTTTGTAATGACAAGGCAGG - Intergenic
1171976992 20:31601599-31601621 GCAGTTTGTAAGGCCAAGCCAGG - Intergenic
1173516629 20:43669083-43669105 GCACTCTGTGAGGCCAAGGCAGG - Intronic
1174241737 20:49141646-49141668 GCACTCTGGAAGGCCAAGGCAGG + Intronic
1175362727 20:58426356-58426378 GAACTCTGTAAGGAATAGCCAGG - Intronic
1177202641 21:17975079-17975101 GCACTTTGGAAGGCCAAGCCAGG + Intronic
1177616827 21:23533493-23533515 CCACCAGGTAAAGACAAGCCAGG + Intergenic
1177844702 21:26275341-26275363 GCACTTTGGAAGGCCAAGCCAGG - Intergenic
1178111357 21:29373157-29373179 CTACTCTGTAAGGAAAATCTTGG - Intronic
1178558471 21:33615398-33615420 GCACTCTGTGAGGCCAAGACAGG - Intronic
1178909421 21:36662360-36662382 GCACTCTGGAAGGCCAAGGCAGG + Intergenic
1179207705 21:39298975-39298997 GCACTTTGTAAGGCCAAGGCAGG + Intronic
1180174309 21:46080286-46080308 CCACGCTGACAGGACAAGTCTGG - Intergenic
1181148739 22:20867410-20867432 ACAGTCTGTAAGGACAGGCCAGG - Intronic
1181405630 22:22683406-22683428 CTGCTCTGTCAGGACAAGACAGG - Intergenic
1181801570 22:25350972-25350994 CCACTTTGTGAGGCCAAGGCGGG + Intergenic
1182221987 22:28765969-28765991 CCACTTTGGAAGGCCAAGGCAGG + Intergenic
1183551404 22:38488525-38488547 CTACTCTGTTGGGAGAAGCCTGG + Intronic
1183813003 22:40273891-40273913 GCACTTTGGAAGGACAAGGCAGG - Intronic
1183914737 22:41108493-41108515 CCACTTTGGAAGGCCAAGGCTGG - Intronic
1184219986 22:43093877-43093899 CCACTTTGGAAGGCCAAGGCAGG - Intergenic
1184736943 22:46404733-46404755 CCACTTTGGAAGGCCAAGGCAGG - Intronic
1184974767 22:48053130-48053152 CAACTCTGTAAGTAGAAGCCAGG - Intergenic
950580395 3:13858284-13858306 CCAGTCTTTGAGGACAGGCCAGG - Intronic
951230455 3:20172701-20172723 GCACTTTGTAAGGCCAAGGCAGG + Intronic
951873963 3:27399676-27399698 GCACTCTGGGAGGACAAGGCAGG - Intronic
952236372 3:31484633-31484655 GCACTCTGTGAGGACAAGACGGG + Intergenic
952441153 3:33330639-33330661 GCACTCTGAGAGGCCAAGCCAGG + Intronic
952459873 3:33513290-33513312 GCACTCTGGGAGGCCAAGCCAGG + Intronic
954827869 3:53391066-53391088 ACACTTTGGAAGGACAAGACAGG - Intergenic
956801562 3:72764292-72764314 GCACTCTGGAAGGCCAAGGCGGG - Intronic
957612183 3:82482545-82482567 GCACTTTGGAAGGCCAAGCCAGG + Intergenic
958071290 3:88616553-88616575 CAGCACTGTAAGGAAAAGCCTGG - Intergenic
959044714 3:101460848-101460870 GCACTCTGGAAGGCCAAGGCAGG + Intronic
961154801 3:124670491-124670513 CATCTCTGTAAGTAGAAGCCTGG - Intronic
961225024 3:125236308-125236330 ACACTCTGTGAGGGCAAGGCAGG - Intronic
961673694 3:128552076-128552098 TCTCTCTGCAAGGACAATCCAGG + Intergenic
962581682 3:136803863-136803885 CCACTTTGGAAGGCCAAGGCAGG - Intergenic
962968301 3:140374402-140374424 TCACTCTGTGAGGACACACCAGG - Intronic
964193815 3:154037929-154037951 GCACTCTGGGAGGTCAAGCCAGG - Intergenic
964942351 3:162174464-162174486 GCACTTTGGAAGGCCAAGCCGGG - Intergenic
967901010 3:194452242-194452264 GCACTCTGGAAGGCCAAGGCGGG + Intronic
968481866 4:836852-836874 GCACTCGGGAAGGACAGGCCTGG + Intergenic
969512333 4:7625890-7625912 GCACTGTGTAAGGCCAAGGCAGG + Intronic
970680942 4:18507187-18507209 CCTCTCTGTCTGGCCAAGCCTGG - Intergenic
971444059 4:26723468-26723490 CCACCCTGTAAGCACTGGCCTGG - Intronic
973943543 4:55934261-55934283 CCACTGTGTTAAGATAAGCCAGG - Intergenic
973975406 4:56257823-56257845 CCACTTTGGAAGGCCAAGGCAGG + Intronic
976283834 4:83351551-83351573 CCACTTTGGAAGGACAAAGCAGG - Intergenic
976785733 4:88818247-88818269 GCACTCTGGAAGGCCAAGTCCGG - Intronic
979189335 4:117836480-117836502 CCACTTTGGAAGGCCAAGCTGGG + Intergenic
979368693 4:119856887-119856909 GCACTCTGGAAGGCCAAGGCAGG + Intergenic
979467791 4:121060425-121060447 ACACTCTGGAAGGCCAAGGCAGG - Intronic
981178235 4:141707850-141707872 CATCTCTGTAAGCTCAAGCCTGG - Intronic
982142517 4:152340329-152340351 CCACTCTGGGAGGCCAAGGCAGG + Intronic
983199031 4:164840886-164840908 GCACTTTGTAAGGTCAAGGCAGG + Intergenic
983584400 4:169340063-169340085 CCACTCAGATAGTACAAGCCTGG + Intergenic
984801633 4:183722130-183722152 GCACTCTGAGAGGACAAGGCGGG + Intergenic
985852295 5:2397671-2397693 GCACTCTGGGAGGACAAGGCGGG - Intergenic
987045188 5:14101325-14101347 GCACTCTGGGAGGCCAAGCCAGG + Intergenic
988554350 5:32223446-32223468 CCACTCTTGGAGGACAAGGCAGG + Intergenic
990759243 5:59110328-59110350 CTACTCTGTAAGGACCTGTCTGG + Intronic
991390245 5:66135263-66135285 CCACTTTGGGAGGACAAGGCAGG + Intergenic
992178945 5:74178039-74178061 ACATTCTGGAAGGACAAGACAGG - Intergenic
992885916 5:81160171-81160193 GCACTCTGGAAGGCCAAGGCGGG + Intronic
993433668 5:87863927-87863949 CTACTCTGTAAGTAAAAGCTAGG + Intergenic
993463718 5:88218539-88218561 GCACTCTGGAAGGCCAAGGCAGG + Intronic
994753254 5:103764459-103764481 CCCCTCAGCATGGACAAGCCGGG - Intergenic
999778202 5:154827792-154827814 CCACTTTGTAAGGCCAAGGCAGG - Intronic
999783523 5:154870328-154870350 GCACTCTGGAAGGCCAAGGCAGG - Intronic
1000560905 5:162788280-162788302 GCACTCTGGAAGGCCAAGGCAGG + Intergenic
1000631711 5:163597824-163597846 CCACTCTGGAAGGACTTTCCAGG + Intergenic
1000650963 5:163818119-163818141 TCTCCCTGTAAGGAAAAGCCTGG - Intergenic
1001551080 5:172602805-172602827 CCACTCTGGCAGGACAAGGAGGG - Intergenic
1002048166 5:176553641-176553663 CCATTGTGTAAGGAACAGCCAGG - Intronic
1002262480 5:178004035-178004057 CCACTTTGGGAGGACAAGGCGGG - Intergenic
1002597791 5:180335397-180335419 CCACTCTGTGGGGAAAAGACAGG + Intronic
1004220787 6:13744442-13744464 CTACTCTGTAAGCACCAGCCAGG + Intergenic
1005327018 6:24712136-24712158 CCACTTTGGGAGGCCAAGCCAGG + Intronic
1006431373 6:33999210-33999232 CCACTGTGGGAGGCCAAGCCAGG - Intergenic
1006756580 6:36421218-36421240 ACACTTTGGAAGGACAAGGCAGG + Intronic
1007077624 6:39078108-39078130 CCTCTCTGTAAGGAAGAGTCTGG + Intronic
1007307818 6:40920684-40920706 CAACCTGGTAAGGACAAGCCTGG - Intergenic
1007910482 6:45508472-45508494 CCACTTTGGAAGGCCAAGGCAGG - Intronic
1008937051 6:57003252-57003274 CCACTTTGAAAGGCCAAGGCAGG + Intronic
1010211562 6:73366393-73366415 CCACTTTGGAAGGCCAAGGCAGG + Intergenic
1010521065 6:76838029-76838051 TCACTCTGTAAGGACTTTCCTGG - Intergenic
1012010436 6:93777883-93777905 CCTCTGTGTAAGGAAAAGCAGGG + Intergenic
1012579467 6:100848857-100848879 ACACTCTGGAAGGTCAAGGCAGG + Intronic
1012737476 6:102968709-102968731 GCACTTTGGAAGGCCAAGCCAGG + Intergenic
1015274900 6:131374048-131374070 GCACTTTGGAAGGCCAAGCCAGG + Intergenic
1015592686 6:134837501-134837523 GCACTCTGGAAGGCCAAGGCGGG + Intergenic
1016531088 6:145058785-145058807 GCACTCTGGAAGGCCAAGGCTGG - Intergenic
1017918617 6:158852788-158852810 ATTCTCTGTAAGGGCAAGCCTGG + Intergenic
1017924252 6:158897022-158897044 CCACTCTGGGAGGCCAAGGCAGG + Intronic
1018184293 6:161252575-161252597 GCACTCTGTAAGGCCAAGGCGGG + Intronic
1018472633 6:164110157-164110179 CCAGGCTGGAAGGACAAGCTCGG - Intergenic
1019529231 7:1495324-1495346 CCACTGAGCCAGGACAAGCCAGG - Intronic
1019781602 7:2943507-2943529 CCACTTTGTAAGGCCAAGGGAGG + Intronic
1020203078 7:6095302-6095324 GGACTCTGTAAGCAAAAGCCTGG + Intergenic
1020413253 7:7916387-7916409 GCACTCTGGAAGGTCAAGGCAGG - Intronic
1022787354 7:33651930-33651952 CCACTATCTAAAGACAAGCAGGG - Intergenic
1023195558 7:37635319-37635341 CCATTCTGGAAGGACAAGGAAGG + Intergenic
1023924107 7:44652645-44652667 GCACTCTGAAAGGCCAAGGCAGG - Intronic
1025782470 7:64613992-64614014 ACACCCTGTAAGGAGAAACCAGG - Intergenic
1025785870 7:64642871-64642893 CTCCTCTGTAAGGACCAGGCAGG - Intergenic
1026352723 7:69531595-69531617 GCACTCTGGAAGGCCAAGGCAGG + Intergenic
1026420825 7:70235382-70235404 GCACTTTGGAAGGACAAGGCTGG - Intronic
1026634939 7:72073939-72073961 ACACTCTGTGAGGCCAAGGCAGG - Intronic
1026767628 7:73170537-73170559 CCACTTTGGAAGGTCAAGGCAGG - Intergenic
1026777332 7:73238940-73238962 CCACTTTGGAAGGCCAAGGCAGG - Intergenic
1027018182 7:74792312-74792334 CCACTTTGGAAGGCCAAGGCAGG - Intergenic
1027069845 7:75153606-75153628 CCACTTTGGAAGGCCAAGGCAGG + Intergenic
1027242340 7:76339840-76339862 GCACTCTGGAAGGCCAAGGCGGG + Intronic
1027490746 7:78823189-78823211 CCACTCTGCAATGACAAGGTAGG - Intronic
1027801834 7:82762886-82762908 GCACTTTGTAAGGCCAAGGCAGG - Intronic
1028499726 7:91506024-91506046 CCACTCTTGAAGAACAAGCTGGG + Intergenic
1028537930 7:91910093-91910115 ACACTCTGAGAGGACAAGGCAGG - Intergenic
1029153073 7:98495085-98495107 GCACTCTGGAAGGCCAAGGCAGG - Intergenic
1030027568 7:105339812-105339834 GCACTCTGGAAGGCCAAGGCAGG + Intronic
1032006434 7:128305674-128305696 CCAGTCTGTATGCACAAGGCGGG - Exonic
1032162326 7:129520465-129520487 GCACTTTGCAAGGACAAGGCGGG - Intergenic
1032180080 7:129668009-129668031 GCACTTTGGAAGGACAAGGCAGG - Intronic
1032229904 7:130065462-130065484 GCACTTTGGAAGGACAAGGCAGG - Intergenic
1033115215 7:138619159-138619181 ACACTTTGGAAGGACAAGGCAGG + Intronic
1033241463 7:139683078-139683100 CCACTCAGTAAGGTCACTCCTGG + Intronic
1034512495 7:151547726-151547748 GCACTTTGGAAGGACAAGACAGG - Intergenic
1036407098 8:8464877-8464899 ACACTCTGGGAGGCCAAGCCGGG - Intergenic
1038517398 8:28199150-28199172 CCACTCAGTCAGGAGAATCCAGG + Intergenic
1038585957 8:28789645-28789667 CCACTCTGGAAGGCCAAGGCGGG + Intronic
1038705394 8:29888922-29888944 CCACTTTGGGAGGACAAGGCAGG + Intergenic
1038844024 8:31212373-31212395 GCACTCTGGGAGGACAAGGCAGG - Intergenic
1040008312 8:42639750-42639772 CCTCTCTGTCAGGGCAATCCTGG - Intergenic
1040850080 8:51891301-51891323 CCACTTTGGGAGGACAAGGCAGG + Intronic
1041550420 8:59094389-59094411 GCACTCTGGGAGGCCAAGCCAGG + Intronic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1042217271 8:66439023-66439045 CCACCGTGAAGGGACAAGCCTGG + Intronic
1042430686 8:68702951-68702973 TCACTCTGTAAGAAAAAGCAAGG - Intronic
1042914899 8:73866029-73866051 CCACTTTGGAAGGCCAAGGCAGG + Intronic
1043953012 8:86330342-86330364 GCACTTTGTAAGGCCAAGGCAGG + Intergenic
1043955437 8:86353727-86353749 GCACTCTGGAAGGCCAAGGCAGG - Intronic
1044558544 8:93590415-93590437 CCACTTTGGAAGGCCAAGGCAGG + Intergenic
1046347785 8:112957692-112957714 GCACTTTGGAAGGACAAGGCAGG - Intronic
1046887626 8:119385292-119385314 GCACTTTGGAAGGCCAAGCCGGG + Intergenic
1046923093 8:119755258-119755280 CCACTTTGGAAGGCCAAGGCGGG + Intronic
1047157775 8:122340518-122340540 GCATTCTGTAAGGACAAGACAGG - Intergenic
1047342826 8:123999397-123999419 GCACTTTGGAAGGCCAAGCCAGG + Intronic
1047795728 8:128253512-128253534 GCACTTTGTGAGGCCAAGCCAGG - Intergenic
1048320363 8:133395076-133395098 CCACTCTGTGAGGACACAGCAGG + Intergenic
1049270281 8:141692023-141692045 CCACTTTGGAAGGTCAAGGCAGG - Intergenic
1050018355 9:1259511-1259533 CTACTCTCTAAGCACTAGCCTGG + Intergenic
1050598981 9:7231660-7231682 CCACTCTGTACAGGTAAGCCAGG + Intergenic
1051018767 9:12514976-12514998 GCACTTTGTGAGGCCAAGCCGGG - Intergenic
1051640053 9:19216132-19216154 GCACTCTGGGAGGCCAAGCCGGG + Intergenic
1051704938 9:19867661-19867683 GCACTTTGGAAGGACAAGGCAGG + Intergenic
1052934282 9:34080097-34080119 GCACTCTGGGAGGACAAGGCAGG + Intergenic
1053216576 9:36275924-36275946 GCACTTTGAAAGGCCAAGCCAGG + Intronic
1054150044 9:61595070-61595092 GCACTTTGGAAGGACAAGGCAGG + Intergenic
1054469808 9:65526172-65526194 GCACTTTGGAAGGACAAGGCAGG + Intergenic
1055285892 9:74727545-74727567 TCCCACTGTAAGGACAAGTCCGG + Intronic
1055533378 9:77210488-77210510 GCACTCTGGAAGGCCAAGGCAGG - Intronic
1056799876 9:89683624-89683646 CCTCTCTGTAGAGACACGCCTGG + Intergenic
1057260078 9:93578013-93578035 CCTCTCTGGAAGGAGAATCCCGG - Intronic
1058699782 9:107590552-107590574 GCACTCTGGAAGGCCAAGACTGG - Intergenic
1058869445 9:109189873-109189895 GCACTCTGGAAGGCCAAGGCGGG - Intronic
1058890359 9:109355866-109355888 ACACTTTGGAAGGACAAGGCGGG - Intergenic
1059500999 9:114754043-114754065 GCACTCTGGGAGGCCAAGCCTGG - Intergenic
1059989429 9:119851204-119851226 CCTCTCTTTGAGGACAAGCCCGG + Intergenic
1061154838 9:128852070-128852092 CCACTCTCTAAGGAAAAGTTGGG + Intronic
1061527078 9:131174698-131174720 CCACTCTGGGAGGCCAAGGCAGG - Intronic
1187517803 X:19988523-19988545 GCACTCTGCAAGGCCAAGGCAGG + Intergenic
1187918785 X:24180627-24180649 CCACTTTGGAAGGCCAAGGCAGG - Intronic
1188466759 X:30490195-30490217 GCACTTTGGAAGGCCAAGCCAGG + Intergenic
1190810087 X:53874680-53874702 CCACTTTGGAAGGCCAAGGCGGG + Intergenic
1190852954 X:54264410-54264432 GCACTCTGGAAGGTCAAGGCAGG - Intronic
1191227888 X:58064798-58064820 CCACTCTGTGAGATCAATCCAGG + Intergenic
1192732635 X:73816557-73816579 CCACTTTGGAAGGACGAGGCAGG + Intergenic
1193631535 X:83894334-83894356 TCTCTCTGTAAAGAAAAGCCTGG - Intergenic
1194274520 X:91862227-91862249 CCTCTCAGTAAAGAAAAGCCTGG - Intronic
1196327777 X:114428534-114428556 GCACTTTGTGAGGACAAGGCAGG + Intergenic
1198209758 X:134506072-134506094 CCACTTTGGGAGGACAAGGCGGG + Intronic
1199262895 X:145796360-145796382 GCACTCTGTGAGGCCAAGGCAGG + Intergenic
1199653201 X:149968744-149968766 GCACTCTGGAAGGCCAAGGCAGG - Intergenic
1200591759 Y:5083633-5083655 CCTCTCAGTAAAGAAAAGCCTGG - Intronic
1201318676 Y:12673310-12673332 GCACTCTGTGAGGCCAAGGCAGG - Intergenic