ID: 923293857

View in Genome Browser
Species Human (GRCh38)
Location 1:232573738-232573760
Sequence CACTGAGAGCGGCCGTTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923293857_923293863 0 Left 923293857 1:232573738-232573760 CCTCACAACGGCCGCTCTCAGTG No data
Right 923293863 1:232573761-232573783 GGTCCAGGGCACATCCTATTCGG No data
923293857_923293868 16 Left 923293857 1:232573738-232573760 CCTCACAACGGCCGCTCTCAGTG No data
Right 923293868 1:232573777-232573799 TATTCGGGGAGAGAAGCCTTTGG No data
923293857_923293864 1 Left 923293857 1:232573738-232573760 CCTCACAACGGCCGCTCTCAGTG No data
Right 923293864 1:232573762-232573784 GTCCAGGGCACATCCTATTCGGG No data
923293857_923293865 2 Left 923293857 1:232573738-232573760 CCTCACAACGGCCGCTCTCAGTG No data
Right 923293865 1:232573763-232573785 TCCAGGGCACATCCTATTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923293857 Original CRISPR CACTGAGAGCGGCCGTTGTG AGG (reversed) Intergenic
No off target data available for this crispr