ID: 923303166

View in Genome Browser
Species Human (GRCh38)
Location 1:232662219-232662241
Sequence TCAGTCATTCTCCTCTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923303166_923303168 -1 Left 923303166 1:232662219-232662241 CCATTAAAGAGGAGAATGACTGA No data
Right 923303168 1:232662241-232662263 AACCCCAGTGCTGTAAGATTGGG No data
923303166_923303174 23 Left 923303166 1:232662219-232662241 CCATTAAAGAGGAGAATGACTGA No data
Right 923303174 1:232662265-232662287 GAGATGTCAGTTATCTCATTTGG No data
923303166_923303171 1 Left 923303166 1:232662219-232662241 CCATTAAAGAGGAGAATGACTGA No data
Right 923303171 1:232662243-232662265 CCCCAGTGCTGTAAGATTGGGGG No data
923303166_923303167 -2 Left 923303166 1:232662219-232662241 CCATTAAAGAGGAGAATGACTGA No data
Right 923303167 1:232662240-232662262 GAACCCCAGTGCTGTAAGATTGG No data
923303166_923303169 0 Left 923303166 1:232662219-232662241 CCATTAAAGAGGAGAATGACTGA No data
Right 923303169 1:232662242-232662264 ACCCCAGTGCTGTAAGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923303166 Original CRISPR TCAGTCATTCTCCTCTTTAA TGG (reversed) Intergenic
No off target data available for this crispr