ID: 923303169

View in Genome Browser
Species Human (GRCh38)
Location 1:232662242-232662264
Sequence ACCCCAGTGCTGTAAGATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923303166_923303169 0 Left 923303166 1:232662219-232662241 CCATTAAAGAGGAGAATGACTGA No data
Right 923303169 1:232662242-232662264 ACCCCAGTGCTGTAAGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923303169 Original CRISPR ACCCCAGTGCTGTAAGATTG GGG Intergenic
No off target data available for this crispr