ID: 923304419

View in Genome Browser
Species Human (GRCh38)
Location 1:232675107-232675129
Sequence GGTGCTCTTGGGAGCAGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923304419_923304431 20 Left 923304419 1:232675107-232675129 CCGCCTCTGCTCCCAAGAGCACC No data
Right 923304431 1:232675150-232675172 CCAGGACATCAGGATTGACTGGG No data
923304419_923304425 2 Left 923304419 1:232675107-232675129 CCGCCTCTGCTCCCAAGAGCACC No data
Right 923304425 1:232675132-232675154 CCATTGCTCACCCATCTACCAGG No data
923304419_923304432 23 Left 923304419 1:232675107-232675129 CCGCCTCTGCTCCCAAGAGCACC No data
Right 923304432 1:232675153-232675175 GGACATCAGGATTGACTGGGTGG No data
923304419_923304429 19 Left 923304419 1:232675107-232675129 CCGCCTCTGCTCCCAAGAGCACC No data
Right 923304429 1:232675149-232675171 ACCAGGACATCAGGATTGACTGG No data
923304419_923304426 10 Left 923304419 1:232675107-232675129 CCGCCTCTGCTCCCAAGAGCACC No data
Right 923304426 1:232675140-232675162 CACCCATCTACCAGGACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923304419 Original CRISPR GGTGCTCTTGGGAGCAGAGG CGG (reversed) Intergenic
No off target data available for this crispr