ID: 923309470

View in Genome Browser
Species Human (GRCh38)
Location 1:232721885-232721907
Sequence TTATATACAAAGATGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923309469_923309470 6 Left 923309469 1:232721856-232721878 CCAGCTTGATTGAGGTTAGAGCT No data
Right 923309470 1:232721885-232721907 TTATATACAAAGATGAAGCCAGG No data
923309467_923309470 24 Left 923309467 1:232721838-232721860 CCTCAGGCAAAGACATCACCAGC No data
Right 923309470 1:232721885-232721907 TTATATACAAAGATGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923309470 Original CRISPR TTATATACAAAGATGAAGCC AGG Intergenic
No off target data available for this crispr