ID: 923314625

View in Genome Browser
Species Human (GRCh38)
Location 1:232767926-232767948
Sequence AAATAACTCTAGTCTAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923314621_923314625 13 Left 923314621 1:232767890-232767912 CCTATTGGACTGGGTTCATAGGA No data
Right 923314625 1:232767926-232767948 AAATAACTCTAGTCTAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923314625 Original CRISPR AAATAACTCTAGTCTAGGCT GGG Intergenic