ID: 923314676

View in Genome Browser
Species Human (GRCh38)
Location 1:232768263-232768285
Sequence TGGGCTTCTGCTAGACTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923314676_923314680 15 Left 923314676 1:232768263-232768285 CCCTCTAGTCTAGCAGAAGCCCA No data
Right 923314680 1:232768301-232768323 TCTTCAACTCCATCAGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923314676 Original CRISPR TGGGCTTCTGCTAGACTAGA GGG (reversed) Intergenic