ID: 923315277

View in Genome Browser
Species Human (GRCh38)
Location 1:232773813-232773835
Sequence CCTGAATGCTGCCTTGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923315270_923315277 11 Left 923315270 1:232773779-232773801 CCGACTTGGGCTTTGGGAGTCGC No data
Right 923315277 1:232773813-232773835 CCTGAATGCTGCCTTGGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923315277 Original CRISPR CCTGAATGCTGCCTTGGCGC CGG Intergenic
No off target data available for this crispr