ID: 923316002

View in Genome Browser
Species Human (GRCh38)
Location 1:232780633-232780655
Sequence TCCCCTTTGGTCCCCAGTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923315998_923316002 27 Left 923315998 1:232780583-232780605 CCATACTTCATGACTTCGTGACA No data
Right 923316002 1:232780633-232780655 TCCCCTTTGGTCCCCAGTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923316002 Original CRISPR TCCCCTTTGGTCCCCAGTAC GGG Intergenic
No off target data available for this crispr