ID: 923321923

View in Genome Browser
Species Human (GRCh38)
Location 1:232842785-232842807
Sequence CAAAGGAAACAGATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923321918_923321923 17 Left 923321918 1:232842745-232842767 CCTGGGATGAGTAGAAACTCAAT No data
Right 923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG No data
923321917_923321923 29 Left 923321917 1:232842733-232842755 CCTAATAAAGGGCCTGGGATGAG No data
Right 923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923321923 Original CRISPR CAAAGGAAACAGATGGAGGA TGG Intergenic
No off target data available for this crispr