ID: 923322362

View in Genome Browser
Species Human (GRCh38)
Location 1:232847402-232847424
Sequence GTGGTACACACTTGGAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923322353_923322362 3 Left 923322353 1:232847376-232847398 CCAGAAACCCGAGAAGGCTTCCC No data
Right 923322362 1:232847402-232847424 GTGGTACACACTTGGAAGAGGGG No data
923322354_923322362 -4 Left 923322354 1:232847383-232847405 CCCGAGAAGGCTTCCCTCAGTGG No data
Right 923322362 1:232847402-232847424 GTGGTACACACTTGGAAGAGGGG No data
923322352_923322362 4 Left 923322352 1:232847375-232847397 CCCAGAAACCCGAGAAGGCTTCC No data
Right 923322362 1:232847402-232847424 GTGGTACACACTTGGAAGAGGGG No data
923322356_923322362 -5 Left 923322356 1:232847384-232847406 CCGAGAAGGCTTCCCTCAGTGGT No data
Right 923322362 1:232847402-232847424 GTGGTACACACTTGGAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923322362 Original CRISPR GTGGTACACACTTGGAAGAG GGG Intergenic
No off target data available for this crispr