ID: 923327624

View in Genome Browser
Species Human (GRCh38)
Location 1:232894865-232894887
Sequence CCAATGGAACAGTAGAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923327624_923327630 11 Left 923327624 1:232894865-232894887 CCCATTTTCTACTGTTCCATTGG No data
Right 923327630 1:232894899-232894921 CAAGCAGACAACCCAGACATAGG No data
923327624_923327633 19 Left 923327624 1:232894865-232894887 CCCATTTTCTACTGTTCCATTGG No data
Right 923327633 1:232894907-232894929 CAACCCAGACATAGGGATGGAGG No data
923327624_923327631 12 Left 923327624 1:232894865-232894887 CCCATTTTCTACTGTTCCATTGG No data
Right 923327631 1:232894900-232894922 AAGCAGACAACCCAGACATAGGG No data
923327624_923327632 16 Left 923327624 1:232894865-232894887 CCCATTTTCTACTGTTCCATTGG No data
Right 923327632 1:232894904-232894926 AGACAACCCAGACATAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923327624 Original CRISPR CCAATGGAACAGTAGAAAAT GGG (reversed) Intergenic
No off target data available for this crispr