ID: 923329915

View in Genome Browser
Species Human (GRCh38)
Location 1:232913529-232913551
Sequence GGTTCTGTTGGAGGACATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923329915_923329924 16 Left 923329915 1:232913529-232913551 CCCAAATGTCCTCCAACAGAACC No data
Right 923329924 1:232913568-232913590 TTTATATTCATGTAATTGCCAGG No data
923329915_923329922 -10 Left 923329915 1:232913529-232913551 CCCAAATGTCCTCCAACAGAACC No data
Right 923329922 1:232913542-232913564 CAACAGAACCTAGGTGGGAGTGG No data
923329915_923329925 17 Left 923329915 1:232913529-232913551 CCCAAATGTCCTCCAACAGAACC No data
Right 923329925 1:232913569-232913591 TTATATTCATGTAATTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923329915 Original CRISPR GGTTCTGTTGGAGGACATTT GGG (reversed) Intergenic
No off target data available for this crispr